We narrowed to 32,627 results for: eng
-
Plasmid#58877PurposeMESA protease chain with Rapamycin FKBP ectodomain and no linker domainDepositorInsertMESA protease chain with FKBP rapamycin-binding ectodomain, TEV protease and mCherry fusion
UseAAVTagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
FnR9-10
Plasmid#182567PurposeHuman fibronectin fragment, type-III repeats 9-10, R1379A mutantDepositorInsertHuman fibronectin fragment, type-III repeats 9-10
TagsHis and TEV cleavage site after His tagExpressionBacterialMutationR1379AAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-cytoFLARE1.0/1.1-TF
Plasmid#234516PurposeTranscriptional reporter for detecting calcium transients in neuronal cultures (transcription factor)DepositorInsertERT2-MK2-hLOV-TEVcs-FLAG-tTA
UseAAVExpressionMammalianAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCfB8788
Plasmid#126922PurposePlasmid containing integration cassette at IntD1 integration site in Yarrowia lipolytica for overexpression of XdCrtI and HMG1DepositorInsertXdCrtI and HMG1
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-Dendra2-Nat
Plasmid#236494PurposePlasmid for deleting or C-terminally tagging endogenous genes with Dendra2 and selection on Nat.DepositorInsertDendra2
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfB8748
Plasmid#126918PurposePlasmid containing integration cassette at IntE1 integration site in Yarrowia lipolytica for overexpression of XdCrtEDepositorInsertXdCrtE
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLITMUS-rpoN-cI-J23106-geneIII
Plasmid#80843PurposePhagemid (encodes M13 gene III and lambda cIopt).DepositorInsertsM13 gene III
Lambda cI
ExpressionBacterialPromoterBBa_J23106 and rpoNAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRANS_212
Plasmid#91111PurposeTransformation, Type: T-DNA, Plant Selection: 2x35S:hpt II, Viral Replication: ToLCVDepositorTypeEmpty backboneExpressionPlantPromoter35SAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ145-ZmUbi-tRNA
Plasmid#158403PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ135-tRNA2.0; assembly of 5 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAX APP C60
Plasmid#30152DepositorInsertAmyloid Precursor Protein C60
ExpressionMammalianMutationfragmentAvailable SinceAug. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-AsCas12f-WT
Plasmid#204635PurposeExpression of wild-type AsCas12f in mammalian cellsDepositorInsertAsCas12f
TagsNLSExpressionMammalianPromoterCMVAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHCKan-yibDp-ald*-alaE
Plasmid#134939PurposeLow phosphate inducible alanine dehydrogenase and alanine exporterDepositorInsertalanine dehydrogenase and L-alanine exporter
ExpressionBacterialPromoteryibDAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_EF1a-->Gss52SR4-LaM4-P2A-NLSIFP
Plasmid#162229PurposeLentiviral vector for the expression of Gss52SR4-LaM4-P2A-NLSIFP in mammalian cellsDepositorInsertLaG17 GFP nanobody SynNotch tTA
UseLentiviralExpressionMammalianAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZ8-P_dCas9
Plasmid#74063PurposepZ8-1 plasmid carrying dcas9 driven by the propionate-inducible prpD2 promoter (PprpD2), KanRDepositorInsertdcas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPropionate inducible promoter (prp)Available SinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSK-Sasg
Plasmid#214350PurposeExpresses cloning backbone for SlugCas9 sgRNADepositorInsertSlugCas9 tracrRNA
ExpressionMammalianAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-pMJ915v2
Plasmid#88916PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only