We narrowed to 11,459 results for: 110
-
Plasmid#224515PurposeA Gateway compatible middle entry clone containing a NLS-EGFP-Cre fusionDepositorInsertnls-EGFP-Cre
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME iCre-I (JDW 1203)
Plasmid#224520PurposeA Gateway compatible middle entry clone containing a loxP flanked, self inactivating Cre that contains an intron to prevent recombination in bacteriaDepositorInsertiCre-I
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-H2A_mCherry_SV40pA (JDW 967)
Plasmid#224528PurposeA Gateway compatible 3' entry clone containing an H2A mCherry fusion followed by SV40 late polyADepositorInsertH2A-mCherry-SV40pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-H2A-mCherry-SV40-pA (JDW 1256)
Plasmid#224532PurposeA Gateway compatible 3' entry clone containing an IRES H2A mCherry followed by a polyADepositorInsertIRES-H2A-mCherry-SV40pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E EFS-rtTA/rtTA3 (JDW 1214)
Plasmid#224533PurposeA Gateway compatible 3' entry clone containing the Human EFS promoter driving rtTA-3rd generation transactivatorDepositorInsertrtTA
UseGateway cloningTagsExpressionMutationPromoterEFSAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-Actin-Vhh-mNeonGreen-HA (JDW 1225)
Plasmid#224534PurposeA Gateway compatible 3' entry clone containing an Actin nanobody fused to mNeonGreen with a c-terminal HA tagDepositorInsertActin-Vhh-mNeonGreen-HA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-mTagBFP2-pA (JDW 1361)
Plasmid#224535PurposeA Gateway compatible 3' entry clone containing an IRES-FLAG-NLS-mTagBFP2-pADepositorInsertIRES-FLAG-NLS-mTagBFP2-pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Lifeact- mScarlet-HA (JDW 1247)
Plasmid#224538PurposeA Gateway compatible middle entry clone containing Lifeact-mScarlet-I (far red f-actin reporter)DepositorInsertLifeact-mScarlet-HA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME H2B mCerulean (JDW 1150)
Plasmid#224543PurposeA Gateway compatible middle entry clone containing a histone H2B fusion to mCerulean to label the nucleusDepositorInsertH2B-mCerulean
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E 5X C120 c-fos min pro (JDW 1241)
Plasmid#224544PurposeA Gateway compatible 5' entry clone containing 5 TAEL transcription factor binding sites and a minimal c-Fos promoterDepositorInsert5x-C120-c-Fos promoter
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3*flag-NEXN
Plasmid#216834Purposeexpressing Falg tag and the coding sequence of mouse NexnDepositorInsertNexn (mus musculus) (Nexn Mouse)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorInsertsgRNA targeting LIG4 exon 3 (LIG4 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-YTHmut-EGFP
Plasmid#209323PurposeAAV packaging vector containing a APOBEC1-YTHmut expression cassette, a P2A-EGFP expression cassette.DepositorInsertAPOBEC1--YTHmut-HA
UseAAVTagsHAExpressionMutationYTH domain lacks AA 385-409 comprising the m6A-bi…PromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Zmynd8-exon minimal CMV pCDNA5
Plasmid#212078PurposeLR vector for integration of Zmynd8-exon into N2a FRT rtTA3 expression cellsDepositorInsertZmynd8-exon (Zmynd8 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Zmynd8+exon minimal CMV pCDNA5
Plasmid#212079PurposeLR vector for integration of Zmynd8+exon(48nt) into N2a FRT rtTA3 expression cellsDepositorInsertZmynd8+exon(48nt) (Zmynd8 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-RPT6-FLAG
Plasmid#205416PurposeExpresses dCas9-RPT6 with FLAG labelDepositorInsertdCas9-RPT6 (Psmc5 Rat)
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 W391A pRK5
Plasmid#206084Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a mutation (W391A) in the ?1-interacting domain (AID) in the I-II loop of Cav2.2 that prevents Beta subunit bindingDepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsGFPExpressionMammalianMutationW391APromoterCMVAvailable sinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 HA W391A pcDNA3
Plasmid#206071Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and a mutation (W391A) in the ?1-interacting domain (AID) in the I-II loop of Cav2.2DepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsExpressionMammalianMutationW391APromoterCMVAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-NLS-3XFLAG-V5
Plasmid#196089PurposeExpresses mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationPromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only