We narrowed to 31,069 results for: SON

#127184

Eukaryotic expression of the fusion protein used for drug diruption the p53-HDM2 interaction

Kai Johnsson

Scarabelli et al ACS Sens. 2017 Aug 25;2(8):1191-1197. do

June 17, 2019

Academic Institutions and Nonprofits only

#125718

ABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19 with CGG RNAP-C

Bryan Dickinson

Pu et al ACS Chem Biol. 2018 Feb 16;13(2):431-437

May 28, 2019

Academic Institutions and Nonprofits only

#102845

Can be used as PCR template for a STAgR reaction

Stefan Stricker

Breunig et al PLoS One. 2018 Apr 27;13(4):e0196015. do

Nov. 28, 2018

Academic Institutions and Nonprofits only

#105427

Synthetic biology

Johannes Stuttmann

Gantner et al PLoS One. 2018 May 30;13(5):e0197185. do

Aug. 1, 2018

Academic Institutions and Nonprofits only

#101150

Fluorescent protein for superresolution imaging and a focal adhesion protein for binding substrate

Xiaowei Zhuang

Wang et al Proc Natl Acad Sci U S A. 2014 Jun 10;11

March 19, 2018

Academic Institutions and Nonprofits only

#89578

caCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locus

George Church

Shapiro et al Nat Microbiol. 2018 Jan;3(1):73-82. doi:

Oct. 2, 2017

Academic Institutions and Nonprofits only

#89886

Human NRasQ61K fused to mCherry downstream of LexOP, placed within a non-autonomous maize dissociation (Ds) element for integration in zebrafish. Contains pCrysB-ECFP for screening.

Tatjana Sauka-Spengler

Kenyon et al Dis Model Mech. 2018 Apr 6;11(4). pii: d

Aug. 9, 2017

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#84361

FRET acceptor for Cdc42 donor, flanked with the far-red FP mMaroon

Ryohei Yasuda

Laviv et al Nat Methods. 2016 Oct 31. doi: 10.1038/n

Nov. 22, 2016

Academic Institutions and Nonprofits only

#56604

Localization: Tight Junctions, Excitation: 515, Emission: 528

Michael Davidson

Dec. 23, 2014

Industry, Academic Institutions, and Nonprofits