We narrowed to 16,223 results for: grn
-
Plasmid#198326PurposeExpresses a guide RNA against a repetitive locus found in the pericentromere of human chromosome 9, with mCherry2 reporterDepositorInsertChr9-CEN guide RNA
ExpressionMammalianPromoterhU6Available SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3E-rev_U6_MCS
Plasmid#109769PurposeMultisite gateway vector for 3' expression of a guide RNA from the U6 promoter (cassette in the reverse orientation). Contains BseRI sites for insertion of gRNA sequenceDepositorInsertU6-gRNA cassette
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2519
Plasmid#91076PurposeModule B, Promoter: OsU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterOsU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_596
Plasmid#176669PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_726
Plasmid#176661PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029726) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_763
Plasmid#176658PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017763) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
5xtetO (tet3) Gene Desert
Plasmid#131339PurposegRNA to insert 5xTet operator sequence into a gene desert on chromosome 5.DepositorInsertDesert-gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_sgACTA2
Plasmid#63712PurposeExpress sgACTA2 in mammalian cells.DepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MTK0_001
Plasmid#123924PurposeEncodes the spCas9 gRNA GFP dropout expression cassette with ConLS and ConRE connectors with Ampicillin resistance as a type 0 part to be used in the MTK systemDepositorInsertTU-sgRNA - L1/RE
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb2-GFP KI
Plasmid#139661PurposeEndogenous tagging of CaVβ2: C-terminal (amino acid position: Q655)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_055
Plasmid#123920PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (bovine u6 promoter and constant region 2) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-for Sp Cas9 bu6_20N_cr2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9
Plasmid#126769PurposeExpression of increased fidelity eSpCas9 in bacterial cellsDepositorInserteSpCas9
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, K1003A, R1060APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9
Plasmid#237460PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SpCas9(D10A)_6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9
Plasmid#237461PurposeTransfection-based all-in-one base editor plasmid that expresses both cytosine base editor (evoCDA1-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_evoCDA1_ssDBD_nickase SpCas9 _6xUGI
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9
Plasmid#237462PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSaCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SaCas9 -6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
LLP1014
Plasmid#239936PurposeHsp18.2 (heat inducible) promoter driving the expression of sgRNA-BDepositorInsertHsp18.2::sgRNA-B
UseSynthetic BiologyExpressionPlantMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP110_AAV Scramble Control
Plasmid#239419PurposeNegative control AAV vector for SaCas9-based CRISPR KODepositorInsertScramble control
UseAAVAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Px-PhiYFP-triplex-28-M13-28-pA
Plasmid#202047PurposeEncodes PhiYFP downstream of a cloning site for constructing a synthetic Cas-targeted promoter. 3’ UTR has a MALAT1 triplex, Csy4 28nt sites, and cloning site for gRNA to activate downstream targets.DepositorInsertPhiYFP
ExpressionMammalianAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only