We narrowed to 11,748 results for: 110
-
Plasmid#240323PurposeEntry vector for Gateway with USP11 (AA535-889)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pDonr 201_USP7_AA535-776
Plasmid#240322PurposeEntry vector for Gateway with USP10 (AA535-776)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7
Plasmid#240319PurposeEntry vector for Gateway with USP7DepositorInsertUSP7 (USP7 Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7_AA1-208
Plasmid#240321PurposeEntry vector for Gateway with USP9 (AA1-208)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonr 201_USP7_C223S
Plasmid#240320PurposeEntry vector for Gateway with USP8 (C223A)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET24+ CUL5(1-384)
Plasmid#246504PurposeRecombinant protein expression of CUL5(1-384)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆48∆11
Plasmid#245369PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆48∆11 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus synthetic 48-bp up…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
TagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
M7138
Plasmid#219774PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of ORCA3 promoter and terminatorDepositorInsertpNOS-HygR-ocsT | pORCA3-nnLuz-ORCA3_T
UseSynthetic BiologyExpressionPlantPromoterpNOS-HygR-ocsT | pORCA3-nnLuz-ORCA3_TAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
M7691
Plasmid#219775PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of WRKY70 promoter and terminatorDepositorInsertpNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_T
UseSynthetic BiologyExpressionPlantPromoterpNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_TAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK3558
Plasmid#219776PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of p35S promoter and act2 terminatorDepositorInsertpNOS-HygR-ocsT | p35S-nnLuz-act2
UseSynthetic BiologyExpressionPlantPromoterpNOS-HygR-ocsT | p35S-nnLuz-act2Available SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only