We narrowed to 14,509 results for: SHR;
-
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148312)
Plasmid#76893Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p4949 pLPCX-His-Xpress NLS hBrd4 CTD
Plasmid#14459DepositorInsertBrd4 CTD (BRD4 Human)
UseRetroviralTagsSV40 NLSExpressionMammalianMutationamino acids 1047-1362 of Brd4 (the CTD). Function…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001146967)
Plasmid#76534Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001149147)
Plasmid#76535Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
shTCF7L2 # 2
Plasmid#42558DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
CCL2 gRNA (BRDN0001148290)
Plasmid#77867Purpose3rd generation lentiviral gRNA plasmid targeting human CCL2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK1
Plasmid#138695PurposeExpresses a human SIK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only