We narrowed to 27,432 results for: cat
-
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (SMAD4)
Plasmid#180191PurposeAAV vector carrying a guide RNA targeting the human SMAD4 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB62 - pL0_STR (pro + 5U)
Plasmid#123186PurposeGolden Gate (MoClo; PRO + 5U) compatible STR1 promoter from Catharanthus roseusDepositorInsertCatharanthus roseus STR1 promoter and 5'UTR
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSB139 - pL0_ZCT1 (CDS1)
Plasmid#123184PurposeGolden Gate (MoClo; CDS1) compatible ZCT1 gene from Catharanthus roseus; a repressor of the STR1 promoter from C. roseusDepositorInsertZCT1 from Catharanthus roseus
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB142 - pL0_ORCA3 (CDS1)
Plasmid#123185PurposeGolden Gate (MoClo; CDS1) compatible ORCA3 gene from Catharanthus roseus; an activator of the STR1 promoter from C. roseusDepositorInsertORCA3 from Catharanthus roseus
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEEF1D-FLAG (pcDNA 3.1+) LG6-1
Plasmid#37365DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (RAB7A)
Plasmid#170118PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-EEF1D (pcDNA 3.1+) LG3-1
Plasmid#37364DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUN1307 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pT3R
Plasmid#203899PurposeReporter plasmid for the T3R promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpT3R-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1308 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pNMT
Plasmid#203900PurposeReporter plasmid for the NMT promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpNMT-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1310 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pDAT
Plasmid#203902PurposeReporter plasmid for the DAT promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpDAT-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSB284 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-pT16H2
Plasmid#203896PurposeReporter plasmid for the T16H2 promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertpT16H2-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUN1305 - pL2_pNOS-RLUC-tNOS_tOCS-FLUC-p16OMT
Plasmid#203897PurposeReporter plasmid for the 16OMT promoter from C. roseus with firefly luciferase readout and Renilla luciferase normalization in a plant binary vector for Agrobacterium-mediated transformation.DepositorInsertp16OMT-FLUC-tOCS; pNOS-RLUC-tNOS
UseLuciferaseExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only