We narrowed to 67,502 results for: cel
-
Plasmid#36997DepositorAvailable SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pEF1α-spider-monkey-retroCHMP3-HA
Plasmid#154179Purposeexpresses spider monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianPromoterEF1alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-HCF-1-B
Plasmid#36996DepositorAvailable SinceMay 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-IgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc
Plasmid#125229PurposeExpresses transmembrane intracellular NanoLuc in mammalian cellsDepositorInsertIgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc
UseAAVTagsHAExpressionMammalianPromoterCMVAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN022
Plasmid#91668PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA CrkII Y221F
Plasmid#50732Purposemammalian expression of CrkII Y221F mutantDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLEX-MAPKAP1Del-FHH-IRES-Puro
Plasmid#120706PurposeExpresses MAPKAP1 Truncation-Flag-HA-6xHIS fusion protein in mammalian cells & for virus productionDepositorInsertMAPKAP1 Isoform 1
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationDeleted amino acids 193-522PromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNB784
Plasmid#60163PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion driven by SIC1 promoter.DepositorInsertFLuc-yEVenus
ExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterSIC1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 DICER1 short UTR
Plasmid#21648DepositorAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJP72
Plasmid#176479PurposeExpresses mScarlet under control of the Capsaspora EF1 promoter and GenR under control of the Capsaspora actin promoterDepositorInsertsactin > GenR
EF1 > mScarlet
UseCapsaspora owczarzaki expressionAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRD21A-mRFP
Plasmid#181959PurposeRD21A protein tagged with mRFP, under control of native promoterDepositorInsertRD21A genomic sequence including 2kb upstream of the ATG
TagsmRFPExpressionPlantPromoterRD21A nativeAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN021
Plasmid#91667PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Am
Plasmid#109364PurposeHuman rod opsin chimera with intracellular loop 3 from Amphioxus opsin 1 with 1D4 tagDepositorInsertRod opsin chimera with Amphioxus Opsin1 intracellular Loop 3 (RHO Human, Branchiostoma belcheri)
Tags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-p107 1*2*
Plasmid#32387DepositorInsertp107 promoter (Rbl1 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianMutation1st and 2nd E2F binding sites mutated: GCG-->A…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pME18S-F-R-hb2AR
Plasmid#149367PurposeExpresses human b2AR in mammalian cells.DepositorAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pILGFP86
Plasmid#83543PurposeUsed to evaluate the expression output of RPL4A promoter with yEGFP used as the reporter gene.DepositorInsertRPL4A promoter-yEGFP
ExpressionYeastPromoterRPL4AAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIS1 Cyclin D2 long-mut-miR15/16
Plasmid#21647DepositorInsertCyclin D2 long-mut-miR15/16 (CCND2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationMutant miR15/16 microRNA binding sitesAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only