We narrowed to 24,377 results for: crispr
-
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK341
Plasmid#192640PurposeExpresses dSpRY and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dSpRY
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dSpRY has s…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AA028
Plasmid#216008PurposeFragmid fragment: (Cas protein) nickase Cas for base editingDepositorHas ServiceCloning Grade DNAInsertnCas9 (D10A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CEP135
Plasmid#227287PurposeDonor template for mStayGold insertion into the N-terminus of the CEP135 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CEP135 (Addgene #227286)DepositorInsertCEP135 Homology Arms flanking a mStayGold Tag (CEP135 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEcNucC
Plasmid#214050PurposeBacterial expression plasmid for E. coli MS 115-1 NucC, a cA3-responsive nuclease known to cause abortive infection; used as a positive control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorInsertEcNucC
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA1-NLS(sv40) (BPK5050)
Plasmid#115136PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7751 pHR Ef1α: mCherry-P2A-AcrIIA4
Plasmid#125148PurposeLentiviral vector for constitutive expression of AcrIIA4 with mCherry fluorescent reporter.DepositorInsertAcrIIA4-P2A-mCherry
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NT)-PGKpuro2ABFP-W
Plasmid#163169PurposeLentiviral plasmid with non-targeting gRNA, co-expression of BFP tagDepositorInsertNon-targeting
UseCRISPR and LentiviralTagsBFPExpressionMammalianPromoterU6Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
BE3-P2A-EGFP (pJUL977)
Plasmid#123612PurposeCAG promoter expression plasmid for rAPOBEC1-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP.DepositorInsertBE3-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pUFlip-floxed2A-KalTA4-; HE1A:BFP -0
Plasmid#180010PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7556 pHR (hU6-crCD46-EFS-PuroR-WPRE)
Plasmid#214880PurposeLentiviral vector encoding RfxCas13d targeting CD46 guideDepositorInserthU6-crCD46-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD003-pCMV-APOBEC-Cas9(D10A)-rPB(8kD)
Plasmid#165445PurposeExpresses ACX, rPB(8kD) in mammalian cellsDepositorInsertAPOBEC-nCas9-rPB(8kD)
ExpressionMammalianAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver4.0
Plasmid#176543PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver4.0
Cas12f-GE ver4.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRDA_936
Plasmid#216094PurposeCas12a [EnAs] knockout targeting CD46, CD47, CD55, CD81, positive controlDepositorInsertCD46, CD47, CD55, CD81 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant
Plasmid#101217PurposeBacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variantDepositorInsertSpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK848A, K1003A, R1060A, N497A, R661A, Q695A and Q9…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only