We narrowed to 4,936 results for: AAT
-
Plasmid#166577PurposeFor expression of human talin head (residues 1-400) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-400) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-400 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4-ΔNs5
Plasmid#173169PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4 with mutation in CHP1 binding siteDepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sites, amino acids …PromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-P2A-BlastDYK-Rluc_miR
Plasmid#163341PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker and a DYK-tagged Blasticidin selection markerDepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Rluc_miR
Plasmid#163330PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Rluc_miR
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001145000)
Plasmid#77402Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_3xflag_NRF2(RR)
Plasmid#136535PurposeLentiviral expression vector for an inducible 3xflag-tagged NRF2(a1584c_a1586t_a1589g)DepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseLentiviral; Destinatioin vector for gateway cloni…Tags3x FLAGExpressionMammalianMutationThis plasmid is developed by mutating 3 base pair…Available SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
t206-405
Plasmid#166132PurposeFor expression of human talin-1 head fragment (residues 206-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-F2F3(206-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 206-405 onlyAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del37/GAG)
Plasmid#166129PurposeExpression of human talin-1 head (aa1-405) in E. coli. Contains 37 amino acid deletion in F1-loop, replaced with Gly-Ala-Gly. N-terminal His6, Xpress-epitopeDLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(del37/GAG) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405, with 37 aa deletion in the F1-loop which…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRC2_3xflag_NRF2(RR)
Plasmid#136522PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseEntry vector for gateway cloningTags3x FLAGMutationThis plasmid is developed by mutating 3 base pair…Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del30)
Plasmid#166128PurposeExpression of human talin-1 head (residues 1-405) in E. coli. Contains 30 amino acid deletion in F1-loop. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-405(del30) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, with 30 amino acid deletion in th…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(T144E,T150E)
Plasmid#166130PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. Includes mutations T144E and T150E. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertHuT1head1-405(T144E,T150E) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, mutations T144E and T150EAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-RFP-NLS-CycB(1-266)_GFP-E2F1(1-230)_neo
Plasmid#73164Purposemulti-cistronic Vector for expression for Fly_FUCCI probes in insect cellsDepositorTagsmRFP1, GFPExpressionInsectMutationCyclin B Fragment aa 1-266 & E2F1 Fragment aa…Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only