We narrowed to 3,718 results for: yfp
-
Plasmid#11388DepositorInsertgolgi associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1 Human)
TagsYFPExpressionMammalianMutationChanged Alanine 193 to Threonine, and Asparagine …Available SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-optoB2-LYY-YFP
Plasmid#75271PurposeG-protein independent version of optoB2 with point mutations at L72F,Y136G,Y224ADepositorInsertG-protein independent version of optoB2
TagseYFPExpressionMammalianMutationpoint mutations at L72F,Y136G,Y224AAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-STChRger2-TS-EYFP
Plasmid#129395PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by human Synapsin I promoter.DepositorInsertsoma targeted ChRger2
UseAAVTagsKv2.1-TS-EYFPExpressionMammalianPromoterhSynAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
plex_307-EYFP-ccdB-blasticidin
Plasmid#201131PurposepLEX_307 plasmid with N-terminal EYFP tag and blasticidin markerDepositorTypeEmpty backboneTagsEYFPExpressionMammalianPromoterEF-1αAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
1099-N-cadherin-AAA-YFP
Plasmid#32237DepositorInsertN-cadherin (Cdh2 Mouse)
TagsEYFPExpressionMammalianMutationGlu–Glu–Asp (aa 780–782) ---> Ala–Ala–AlaPromoterCMVAvailable SinceOct. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-G418
Plasmid#158550PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-mYFP
Plasmid#105144PurposeYeast gene targetingDepositorInsertkanMX6-P81nmt1-mYFP
Tags81nmt1-mYFPExpressionBacterial and YeastMutationA206KPromoter81nmt1Available SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV Aquamarine-superYFP tandem
Plasmid#157776PurposeProduces a fusion between Aquamarine and superYFP. It can be used as a positive control for FRET (using FLIM)DepositorTypeEmpty backboneTagsAquamarine and superYFPExpressionMammalianAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJM502 ZF1x6-C EYFP in TUPV1
Plasmid#161527PurposeInducible expression of EYFP under the ZF1x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF1x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CUP Ent2 YFP p316
Plasmid#15593DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLenti/TO/EYFP-P2A-IDH1(HA)
Plasmid#122482PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HADepositorInsertisocitrate dehydrogenase 1 (IDH1 Human)
UseLentiviralTagsHA and P2AExpressionMammalianPromoterCMV/TOAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGM-ENO2-mCherry-YFP
Plasmid#180570PurposeDual fluorescent reporter for 5' UTR activity in yeast mCherry/YFPDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGM-ENO2-YFP-mCherry
Plasmid#180569PurposeDual fluorescent reporter for 5' UTR activity in yeast YFP/mCherryDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJM587 ZF10x6-C EYFP in TUPV2
Plasmid#161530PurposeInducible expression of EYFP under the ZF10x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF10x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal-RNQ1-YFP
Plasmid#18685DepositorAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only