We narrowed to 15,910 results for: grna
-
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
rGluA1 (px330:2-guideCas9)
Plasmid#169437PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRExpressionMammalianAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgOprk1
Plasmid#159903PurposeMutagenesis of Oprk1DepositorInsertOprk1 (Oprk1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral nontargeting shRNA GFP
Plasmid#155285PurposeLentiviral expression of nontargeting shRNA, GFP expression, based on Addgene 12247DepositorInsertNontargeting shRNA
ExpressionMammalianAvailable sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pADsacA
Plasmid#158649PurposeConstitutive transcription of sacA crRNA and GFPDepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-eCas9-sgNT
Plasmid#140238PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a control non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-3'UTR
Plasmid#136056PurposeUSP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT)DepositorAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable sinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna5
Plasmid#127649PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg2
Plasmid#124857PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin2a
Plasmid#124850PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shSNAI1
Plasmid#115467PurposeConstitutive lentiviral expressionDepositorAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
shPBRM1#32-Tet-pLKO-puro
Plasmid#107399PurposeLentiviral expression of shRNA targeting PBRMDepositorInsertshRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plko.1/shMCT4 477
Plasmid#99598PurposeKnockdown of MCT4 expressionDepositorInsertMCT4 (SLC16A3 Human)
UseLentiviralAvailable sinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-BNIP3-FL
Plasmid#100771PurposeLentiviral expression of shRNA targeting BNIP3DepositorInsertLenti-sh-BNIP3-FL
UseLentiviralExpressionMammalianPromoterhU6Available sinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO-Tet-On-HDAC1-shRNA2
Plasmid#90241PurposeLentivirus for expression of shRNA2 against human HDAC1 (Dox-inducible)DepositorInsertHDAC1 (HDAC1 Human)
UseLentiviralAvailable sinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shOrai1
Plasmid#89933PurposeKnockdown human Orai1 expressionDepositorInsertOrai1 shRNA (ORAI1 Human)
UseRetroviralAvailable sinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV4-A
Plasmid#74975PurposeshETV4 shRNADepositorAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only