We narrowed to 41,782 results for: LAT;
-
Plasmid#175748PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6deltaE3 and pAd5-B7.DepositorInsertAdenovirus 5 genomic region 25043-35938
UseAdenoviral and Synthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDD121
Plasmid#91833PurposeCas9 expression in C. elegansDepositorInsertCas9
UseCRISPRExpressionWormMutationCodon optimized and with synthetic introns for C.…Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJAT62
Plasmid#204301PurposeExpress phiC31 under control of D. melanoagaster vasa promoter, with Vasa 3’UTR.DepositorInsertie1-EGFP
UseCRISPRPromoterie1Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIREVOL)-mNG
Plasmid#189722Purposetitratable expression of mNeonGreen in bacteriaDepositorInsertmNeonGreen
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
YEp181-CUP1-His-Smt3
Plasmid#99536PurposeYeast episomal vector for expression of His-tagged Smt3 (SUMO); LEU2 markerDepositorAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-4493NES(Booster-PKA)
Plasmid#184709PurposePKA biosensorDepositorInsertBooster-PKA
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
hSDH5
Plasmid#113046PurposeExpression of WT hSDH5DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
H6-auxilin
Plasmid#62571Purpose6xHis-tagged full-length bovine brain auxilin (auxilin 1) in pQE30 for protein expression in bacteriaDepositorInsertAuxilin
Tags6XHisExpressionBacterialMutation*see comment belowAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cytoFLARE1.0/1.1-TF
Plasmid#234516PurposeTranscriptional reporter for detecting calcium transients in neuronal cultures (transcription factor)DepositorInsertERT2-MK2-hLOV-TEVcs-FLAG-tTA
UseAAVExpressionMammalianAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV5B-Flag-Par6 wt
Plasmid#11748DepositorAvailable SinceAug. 4, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHA-PUMA DeltaBH3
Plasmid#16589DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
B2088_BTB-IDR-FRB
Plasmid#215101PurposeExpresses BCL6 BTB(1-129)-mCherry-FUS (IDR)-FRB in mammalian cellsDepositorInsertBTB-mCherry-FUS(IDR)-FRB
ExpressionMammalianPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human USP30 (64-502, construct 8, MG-26-21)
Plasmid#110745PurposeBacterial expression of human USP30 (construct 8)DepositorInsertUSP30 (USP30 Human)
TagsN-His6-3C-GST-3CExpressionBacterialMutationF348D, M350D, I353E + insertion deletion: 64-357;…PromoterT7Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBP-lldR
Plasmid#74095PurposeL-lactate repressor (LldR) from E. coli MG1655DepositorInsertlldR
UseSynthetic BiologyExpressionBacterialPromoterNoneAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTn7xTS-dTomato
Plasmid#117391PurposeTn7 tagging vector pTn7xTS with dTomato expression scaffoldDepositorInsertdTomato
UseSynthetic BiologyExpressionBacterialPromoterPtacAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACYCDuet_WTDHFR_WTTS
Plasmid#91226Purposebacterial co-expression of folA (DHFR) and thyA(TS) with a barcode within the noncoding region between the genesDepositorInsertsfolA
thyA
Tags6xHisExpressionBacterialPromoterT7Available SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
MXS_E2-Crimson
Plasmid#62410PurposeMXS_chaining vector with E2-CrimsonDepositorInsertE2-Crimson
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1
Plasmid#221494PurposeNKX2-1 short isoform lentiviral overexpression using hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only