We narrowed to 11,347 results for: 158
-
Plasmid#195068PurposeExpresses FLAG-tagged Drosophila tws proteinDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pRK5-mEGFP-HMGB1-delFS
Plasmid#194555PurposeMammalian Expression of mEGFP-HMGB1 WT Fusion Protein, "del FS" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationtruncation by stop codon after Lys183Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-Rdel
Plasmid#194556PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R del" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationDeletion of Arginines after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RorKtoA
Plasmid#194558PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R or K > A" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationR or K > A substitutions after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-DVL1-MUT
Plasmid#194587PurposeMammalian Expression of mEGFP-DVL1 Mutant (H502Pfs*143) Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RtoA
Plasmid#194557PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R > A" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationR > A substitutions after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT647 human L1 ORF2p-3xFlag only (ORFeus-Hs, CMV promoter, monocistronic construct) in pCEP4 Puro (derivative of pMT646)
Plasmid#213029PurposeExpresses human LINE-1 ORF2 only in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 ORF2p only (monocistronic, codon optimized ORFeus-Hs sequence) with ORF2-3xFlag
Tags3xFlagExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT870 human L1 RT- (ORF2p D702Y) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213027PurposeExpresses reverse transcriptase dead (RT- ORF2p D702Y) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, RT- D702Y) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationD702Y (RT- reverse transcriptase catalytic dead)PromoterCMVAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a G1202R
Plasmid#183830PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationG1202RPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a L1196M/G1202R
Plasmid#183831PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK L1196M/G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationL1196M/G1202RPromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT1093 human L1 EN- (ORF2p E43S, D145N) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213028PurposeExpresses endonuclease dead (EN- ORF2p E43S, D145N) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, EN- E43S D145N) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationE43S D145N double mutant EN- endonuclease catalyt…PromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DB
Plasmid#215482PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSrTA1662-toolkit
Plasmid#154372PurposeExpresses SrTA1662 in plantsDepositorInsertSrTA1662
ExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-QZ213
Plasmid#215484PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-AD-CYH2
Plasmid#215483PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-AD-AR68
Plasmid#215485PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro
Plasmid#141395PurposeLentiviral expression of SARS-CoV-2 protein; transient expression and generate lentivirusDepositorInserteGFP
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only