We narrowed to 3,749 results for: yfp
-
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti/TO/EYFP-P2A-IDH1(HA)
Plasmid#122482PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HADepositorInsertisocitrate dehydrogenase 1 (IDH1 Human)
UseLentiviralTagsHA and P2AExpressionMammalianPromoterCMV/TOAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJM502 ZF1x6-C EYFP in TUPV1
Plasmid#161527PurposeInducible expression of EYFP under the ZF1x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF1x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CUP Ent2 YFP p316
Plasmid#15593DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGM-ENO2-mCherry-YFP
Plasmid#180570PurposeDual fluorescent reporter for 5' UTR activity in yeast mCherry/YFPDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGM-ENO2-YFP-mCherry
Plasmid#180569PurposeDual fluorescent reporter for 5' UTR activity in yeast YFP/mCherryDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal-RNQ1-YFP
Plasmid#18685DepositorAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJM587 ZF10x6-C EYFP in TUPV2
Plasmid#161530PurposeInducible expression of EYFP under the ZF10x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF10x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
N-TAP A2A-YFP pcDNA3
Plasmid#67852Purposemammalian expression of A2A receptor with N terminal TAP tag and C terminal YFP fusionDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CUP Pan1 YFP p316
Plasmid#15592DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pASH3 [pmyo-3::BeCNG1-YFP]
Plasmid#168167PurposeExpression of BeCNG1-YFP in BWMs of C. elegansDepositorInsertBeCNG1-YFP
TagsYFPExpressionWormAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-ABI2-YFPn-1
Plasmid#102383Purposesplit YFP. Plant expression of ABI2-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
PacrAB-rfp + PmutS-yfp
Plasmid#121442Purposeplasmid reporting the expression from the acrAB and mutS promotersDepositorInsertsPmutS-yfp
PacrAB-rfp
UseSynthetic Biology; Pbb vectorExpressionBacterialPromoterPacrAB and PmutSAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSF-p15A-tac- YFP
Plasmid#186570Purposep15A ori, lacI, Ptac promoter, AmpR. Kringle YFP (Yellow Fluorescence Protein) expressionDepositorInsertYFP
ExpressionBacterialPromotertac promoterAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger3-TS-EYFP
Plasmid#127241PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-Lyk5-YFPn-1
Plasmid#102389Purposesplit YFP. Plant expression of Lyk5-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only