We narrowed to 69,679 results for: TOR
-
Plasmid#88678PurposeDonor Vector containing ZNF76 transcription factor, part of the Human TFome CollectionDepositorInsertZNF76 (ZNF76 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF32
Plasmid#88309PurposeDonor Vector containing ZNF32 transcription factor, part of the Human TFome CollectionDepositorInsertZNF32 (ZNF32 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF716
Plasmid#101481PurposeDonor Vector containing ZNF716 transcription factor, part of the Human TFome CollectionDepositorInsertZNF716 (ZNF716 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF680
Plasmid#88455PurposeDonor Vector containing ZNF680 transcription factor, part of the Human TFome CollectionDepositorInsertZNF680 (ZNF680 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF165
Plasmid#88444PurposeDonor Vector containing ZNF165 transcription factor, part of the Human TFome CollectionDepositorInsertZNF165 (ZNF165 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR182
Plasmid#106061PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR182; Opto-GPR182; F3)DepositorInsertOpto-GPR182 (GPR182 Bovine, Human)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR37L1
Plasmid#106020PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR37L1; Opto-GPR37L1; B10)DepositorInsertOpto-GPR37L1 (GPR37L1 Bovine, Human)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF467
Plasmid#88643PurposeDonor Vector containing ZNF467 transcription factor, part of the Human TFome CollectionDepositorInsertZNF467 (ZNF467 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AT5G48740 O3_pECIA2
Plasmid#114963PurposeBait vector AT5G48740 O3_pECIA2 should be used with prey vector AT5G48740 O3_pECIA14.DepositorInsertAT5G48740 (AT5G48740 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT5G59650 O4_pECIA2
Plasmid#114964PurposeBait vector AT5G59650 O4_pECIA2 should be used with prey vector AT5G59650 O4_pECIA14.DepositorInsertAT5G59650 (AT5G59650 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF674
Plasmid#88785PurposeDonor Vector containing ZNF674 transcription factor, part of the Human TFome CollectionDepositorInsertZNF674 (ZNF674 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-H2BmCherry-OptoJNKi
Plasmid#89741PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to chromatin with H2B, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseOptogeneticsTagsHistone2B and mCherryExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF98
Plasmid#88567PurposeDonor Vector containing ZNF98 transcription factor, part of the Human TFome CollectionDepositorInsertZNF98 (ZNF98 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab7A
Plasmid#135651PurposeRab7A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AR-R405S
Plasmid#126051PurposeExpresses human androgen receptor (R405S) in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF670
Plasmid#88337PurposeDonor Vector containing ZNF670 transcription factor, part of the Human TFome CollectionDepositorInsertZNF670 (ZNF670 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF800
Plasmid#88573PurposeDonor Vector containing ZNF800 transcription factor, part of the Human TFome CollectionDepositorInsertZNF800 (ZNF800 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only