We narrowed to 4,446 results for: gca
-
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LEP-shREN
Plasmid#105580Purposeretrovirally express control shRNA with puro resistance and GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-OSBP
Plasmid#32495DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT1_1
Plasmid#106311PurposeExpress Cas9 and sgRNA targeting SHMT1DepositorInsertsgRNA targeting SHMT1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3042(gRNA X-4)
Plasmid#73284PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shREN
Plasmid#105585PurposeDox-inducible mirE shREN(control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Pdha1
Plasmid#175936Purposeknockout mouse Pdha1DepositorInsertPdha1 gRNA (Pdha1 Mouse)
UseRetroviralAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPU-Empty-miR30-TRIM5
Plasmid#132936PurposeAll-in-one control rescue-TRIM5 shRNA knockdown vectorDepositorInsertcontrol shRNA
UseLentiviral and RNAiTagsHAExpressionMammalianPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pyc128m
Plasmid#158778Purposesoluble GCaMP expressionDepositorInsertGCaMP6m
UseAAVAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
1161F
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop A
Plasmid#171776PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-SpyTag003 Loop A
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues V…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1344
Plasmid#119273Purposeknockdown folA in E. aerogenesDepositorInsertsgRNA folA (E. aerogenes)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJG493
Plasmid#91197PurposeWDV replicon T-DNA for gene targeting in wheat scutella, no Cas9 control (gUbi1+gUbi8+donor)DepositorInsertgUbi1+gUbi8+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD2_3
Plasmid#36370DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
PX458_HLF_2
Plasmid#86302PurposeEncodes gRNA for 3' target of human HLFDepositorInsertgRNA against HLF (HLF Human)
UseCRISPRAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only