We narrowed to 1,030 results for: control gRNA
-
Plasmid#80186Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147649)
Plasmid#80187Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148129)
Plasmid#80177Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM123: pAAV-EFS-CasRx-control presgRNA
Plasmid#166871PurposeAAV vector for expressing CasRx and control presgRNA for RNA-editingDepositorInsertsU6-control presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-control-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128347PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorInsertcontrol (negative)
UseCRISPRExpressionMammalianAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
E42_gControl_dTet_IRES_mTurquoise2
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_control_NGFR
Plasmid#189800PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-Control
Plasmid#233611PurposeExpression of guide RNA for PspCas13bDepositorInsertControl gRNA
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shControl
Plasmid#242699PurposeshRNA controlDepositorInsertshControl
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
HoxD del control ds
Plasmid#131336PurposegRNA to delete control region near HoxD. Use with HoxD del control usDepositorInsertCTRL-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HoxD del control us
Plasmid#131335PurposegRNA to delete control region near HoxD. Use with HoxD del control dsDepositorInsertCTRL-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6>Control(F+E)
Plasmid#60006PurposeU6 promoter driving control (F+E) sgRNADepositorInsertControl (F+E) sgRNA
UseCRISPRPromoterCiinte.U6Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-control
Plasmid#216859PurposeCIRTS RNA targeting system for targeted removal of m6A on transcript at the synapse. CIRTS-FTO-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-control gRNA
UseLentiviralTagsmCherry2ExpressionMammalianPromoterSyn1, U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-control
Plasmid#216857PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing transcript at the synapse. CIRTS-YTHDF2-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEmpty_Control
Plasmid#162607PurposeEmpty control for Cas9 experiments and to clone new guide RNAs for paperDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only