We narrowed to 133 results for: lentiviral green fluorescent protein
-
Plasmid#155032PurposeFluorescent reporter for ATF4 translationDepositorAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pSMALB-ATF4.12
Plasmid#155033PurposeFluorescent reporter for ATF4 translation, Negative ControlDepositorInsertsUseLentiviralExpressionMammalianMutationuORF1 start codon mutatedAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMALB-ATF4.14
Plasmid#155034PurposeFluorescent reporter for ATF4 translation, Positive ControlDepositorInsertsUseLentiviralExpressionMammalianMutationuORF1 and uORF2 start codons mutatedAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn2
Plasmid#59358PurposeLentiviral expression vector: Neuroligin 2 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSico-CAG-v-H-Ras-IRES-Luciferase/EGFP
Plasmid#58959Purposelentiviral expression of v-H-Ras and luciferase/EGFP reporterDepositorInsertsCMV enhancer/chicken beta actin promoter
v-H-Ras
luc2/EGFP fusion gene
UseLentiviralExpressionMammalianPromoterCMV enhancer/chicken beta actinAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-EGFP
Plasmid#84041Purpose3rd generation lentiviral transfer plasmid. Expresses EGFP and puromycin resistance in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertEnhanced Green Fluorescence Protein, Puromycin resistance gene
UseLentiviralExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP PuroR
Plasmid#128958PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP NeoR
Plasmid#128960PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CamKIIa_GFP
Plasmid#96941PurposeTo label mature excitatory iPSC-derived human neuronsDepositorInsertGreen fluorescent protein
UseLentiviralPromoterCaMKIIaAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP shRNA tet pLKO puro
Plasmid#163017PurposeControl tet-inducible shRNA targeting eGFPDepositorInsertEnhanced Green Fluorescent Protein
UseLentiviralAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-lxlplap
Plasmid#45581DepositorInsertsUseLentiviralTagsHistone 2BExpressionMammalianPromoterUbiquitinAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR-TAF15N-miRFP670-Cry2WT
Plasmid#122440PurposeExpresses disordered protein TAF15(1-208) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertTAF15 (TAF15 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationContains only amino acids 1-208PromoterSFFVAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
mNG2(1-10)_tdTomato
Plasmid#184169PurposeLentiviral vector for expression and selection of the mNG2(1-10) split fluorescent protein.DepositorInsertsmNG2(1-10)
tdTomato
UseLentiviralExpressionMammalianAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only