We narrowed to 6,915 results for: crispr cas9 plasmids
-
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-T7-BPNLS-ABE8e(V106W)-SpCas9(D10A)-BPNLS-P2A-EGFP (CA77)
Plasmid#208290PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpCas9(D10…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PsppA-mCherry
Plasmid#225428PurposePlasmid encodes SgRNA, SpCas9 and homologous arms for homologous recombination of mCherryDepositorInsertmCherry, Cas9, SgRNA
UseCRISPRExpressionBacterialPromoterPsppA upstream of mCherry and Cas9, P3 upstream o…Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS2
Plasmid#69228PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS2 in mammalian cellDepositorInsertTS2 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS4
Plasmid#69230PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS4 in mammalian cellDepositorInsertTS4 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only