We narrowed to 18,078 results for: comp
-
Plasmid#36959DepositorAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-ZNF716
Plasmid#101481PurposeDonor Vector containing ZNF716 transcription factor, part of the Human TFome CollectionDepositorInsertZNF716 (ZNF716 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF680
Plasmid#88455PurposeDonor Vector containing ZNF680 transcription factor, part of the Human TFome CollectionDepositorInsertZNF680 (ZNF680 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF436
Plasmid#88589PurposeDonor Vector containing ZNF436 transcription factor, part of the Human TFome CollectionDepositorInsertZNF436 (ZNF436 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTT3-SP-6xHis-KIR2DL1(FL)-FLAG
Plasmid#157625PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF165
Plasmid#88444PurposeDonor Vector containing ZNF165 transcription factor, part of the Human TFome CollectionDepositorInsertZNF165 (ZNF165 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTT3-SP-6xHis-KIR2DL4(FL)-FLAG
Plasmid#157624PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1097
Plasmid#29028PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle201 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSExpressionMutationPromoterAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-PolB-Hygro
Plasmid#176056PurposeEGFP fused to the N-terminus of PolB & a hygromycin resistance cassetteDepositorAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF467
Plasmid#88643PurposeDonor Vector containing ZNF467 transcription factor, part of the Human TFome CollectionDepositorInsertZNF467 (ZNF467 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TE)
Plasmid#61522PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TE mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TE mutation (see comments), Tom20, and m…ExpressionMammalianMutationPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF280C
Plasmid#88658PurposeDonor Vector containing ZNF280C transcription factor, part of the Human TFome CollectionDepositorInsertZNF280C (ZNF280C Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF674
Plasmid#88785PurposeDonor Vector containing ZNF674 transcription factor, part of the Human TFome CollectionDepositorInsertZNF674 (ZNF674 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyTagsExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMG035 MBP-Axin∆BCD-His
Plasmid#154053PurposeExpresses MBP-Axin∆BCD-His (human Axin with aa465-518 deletion as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF98
Plasmid#88567PurposeDonor Vector containing ZNF98 transcription factor, part of the Human TFome CollectionDepositorInsertZNF98 (ZNF98 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP SRBC
Plasmid#68399PurposeExpression of fluorescently tagged SRBC in mammalian cellsDepositorAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
UseTagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…PromoterAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only