We narrowed to 23,602 results for: crispr
-
Plasmid#138178PurposeCRISPR SONIC: Kras G12D luciferase donor plasmid.DepositorInsertKrasG12D (Kras Mouse)
UseNhej donorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-mClover3-CD4-bla
Plasmid#179448PurposeDonor vector to knock in mClover3 N-terminal to human PER2 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGLOW39
Plasmid#173068PurposemScarlet^SEC^3xMyc vector with ccdB sites for cloning homology armsDepositorInsertmScarlet-I-C1^SEC^3xMyc
UseCRISPR and Cre/LoxTags3xMyc and C. elegans codon-optimized mScarletExpressionWormAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiP (CRONUS-Puro)
Plasmid#100596PurposepiggyBac vector expressing Dual-regulated Cas9 (Puro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT105
Plasmid#180510PurposePlasmid expressing mammalian codon optimized engineered DpbCasX-R3, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
DpbCasX with R3 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-mScarlet-I-CD4-bla
Plasmid#179449PurposeDonor vector to knock in mScarlet-I C-terminal to human PER2 geneDepositorInsertmScarletI
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-AdmCas13d-msfGFP-NES-Flag
Plasmid#165075Purposeoverexpression of AdmCas13d in human cellsDepositorInsertAdmCas13d
ExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4
Plasmid#123657PurposeDD-AcrIIA4 fusion for Shield1-mediated AcrIIA4 control with sgRNA driving TRE3G activation.DepositorInsertmCherry-P2A-DD-AcrIIA4
UseCRISPR, Lentiviral, and Synthetic BiologyTagsmCherry-P2AExpressionMammalianPromoterCMV and mU6Available SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
SPACE-VRQR (pRZ5137)
Plasmid#140245PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_VRQR-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_VRQR
ExpressionMammalianMutationV82G in TadA*, VRQR mutations in SpCas9, D10A in …PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Dicot Edit E1_NTERM (GB2245)
Plasmid#160567PurposetRNA and scaffold for the assembly of GBoligomers for position [D1_n] of a monocistronic tRNA-gRNADepositorInsertMultiplexing Dicot Edit E1_NTERM (Multiplexing Dicot Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-14aa-TET1cd
Plasmid#106436PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS (TET1 Human, Mustard Weed, Synthetic)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-mClover3-CD4-bla
Plasmid#179441PurposeDonor vector to knock in mClover3 C-terminal to human CRY1 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-Elf5 gRNA
Plasmid#128836PurposegRNA for targeting mouse Elf5 loci using CRISPR-cas techniqueDepositorInsertmElf5 gRNA (Elf5 Mouse)
UseCRISPRAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only