We narrowed to 24,624 results for: crispr
-
Plasmid#241901PurposettLbCas12a (LbCas12a-D156R)-intron Gateway entry plasmidDepositorInsertttLbCas12a (LbCas12a-D156R)-intron
UseCRISPRTagsNLSExpressionPlantAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-22
Plasmid#246305PurposeEvaluation of MtU6.6-70 promoter (Pol III promoter) deletion (70 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-70 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-70 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-21
Plasmid#246304PurposeEvaluation of MtU6.6-104 promoter (Pol III promoter) deletion (104 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-104 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-104 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-20
Plasmid#246303PurposeEvaluation of MtU6.6-189 promoter (Pol III promoter) deletion (189 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-189 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-189 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM2_Euk_2NLS-RVQ (LbCas12a)-2NLS
Plasmid#244837PurposeMammalian expression of LbCas12a-RVQ with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a-RVQ
UseCRISPRTags2xSV40 NLSExpressionMammalianMutationG146R/R182V/E795QPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS641_Flex-Cas12a-ABE
Plasmid#244846PurposeMammalian expression of Flex-Cas12a adenine base editorDepositorInsertFlex-dCas12a-ABE
UseCRISPRTagsSV40 NLS-ABE8eExpressionMammalianMutationG146R/R182V/D535G/S551F/D665N/E795Q/D832APromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-VP64
Plasmid#235595PurposeExpresses the dCas9-VP64 under the control of human EF1a promoterDepositorInsertdCas9-VP64
UseCRISPRTagsNLSExpressionMammalianPromoterEF1aAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AaCas12b-T2A-EGFP
Plasmid#188271PurposeMammalian expression, Genome editingDepositorInsertAaCas12b
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AaCas12b(Q119F/E475R/E758R)-T2A-EGFP
Plasmid#188272PurposeMammalian expression, Genome editingDepositorInsertAaCas12b(Q119F/E475R/E758R)
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-mCherry-C
Plasmid#159437PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertmCherry
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterCMVAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
JME5000
Plasmid#129661PurposeEYK1ex_CrisprCas9-yl_RFP: CAS9 vector with EYK1ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PV564
Plasmid#132349PurposeSthCascade R promoter targeting crRNA1 expression cassette for Zea maysDepositorInsertSthCascade R promoter targeting crRNA1
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV565
Plasmid#132350PurposeSthCascade R promoter targeting crRNA2 expression cassette for Zea maysDepositorInsertSthCascade R promoter targeting crRNA2
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV569
Plasmid#132351PurposeSthCascade R promoter targeting crRNA3 expression cassette for Zea maysDepositorInsertSthCascade R promoter targeting crRNA3
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0015
Plasmid#117551PurposeLevel 1 Golden Gate Cassette: SaCas9 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SaCas9 (no stop codon) (pEPOR0SP0012) + YFP (pICSL50005) + Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only