We narrowed to 23,290 results for: crispr
-
Plasmid#140244PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_NG
ExpressionMammalianMutationV82G in TadA*, NG mutations in SpCas9, D10A in Sp…PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGT9569
Plasmid#219431PurposeTranscriptional unit (MoClo-position 2): pAtRPS5a_PapE-4LF2-N-SpCas9i-N_tNOSDepositorInsertLB_AtRPS5a:PapE-4xLF2-NLS-SpCas9i-NLS:tNOS_RB (Position 2)
UseCRISPR and Synthetic Biology; Moclo compatible le…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAT527
Plasmid#180514PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, mNeonGreen, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-LwaCas13a-msfGFP-NES-Flag
Plasmid#165070Purposeoverexpression of LwaCas13a in human cellsDepositorInsertLwaCas13a
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_Efs_hSpCas9_NLS_FLAG-SV40
Plasmid#97307PurposeAAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoterDepositorInserthumanized S. pyogenes Cas9
UseAAV and Mouse TargetingTagsFlagExpressionMammalianPromoterEFSAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Venus
Plasmid#70267PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and Venus reporter from EFS promoter. Lentiviral backbone.DepositorInsertsCas9
Venus Reporter
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NS and P2AAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPV-EF1a-2xNLS-Cas7-Cas5-Cse1-iCA
Plasmid#134922PurposeComponents for genome editing in mammalian cells with pPV-EF1a-2xNLS-Cse2-Cas6-Cas3-iCA and pBS-U6-crRNA-targeted. This plasmid was optimized for iPS cells and coexpresses mCherry protein.DepositorInsertCascade factors (Cse1(Cas8), Cas5,Cas7) with bpNLS
ExpressionMammalianPromoterEF1aAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Efs_hSpCas9_NLS_FLAG-WPRE
Plasmid#97313PurposeLentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter.DepositorInserthumanized S. pyogenes Cas9
UseLentiviral and Mouse TargetingTagsFlagExpressionMammalianPromoterEFSAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 P35S:MS2:VPR:Tnos - P35S:dCas9:EDLL:Tnos (GB2085)
Plasmid#160645PurposeModule for the expression of Ms2 protein fused to VPR and dCas9 fused to EDLLDepositorInsertP35s-Ms2:VPR-Tnos-35s-dCas9:EDLL-Tnos
UseSynthetic BiologyExpressionPlantMutationBsmBI sites removedPromoter35S x2Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Luciferase-hvTK-bla
Plasmid#179450PurposeDonor vector to knock in firefly Luciferase C-terminal to human PER2 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-mClover3-CD4-bla
Plasmid#179448PurposeDonor vector to knock in mClover3 N-terminal to human PER2 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPV-EF1a-2xNLS-Cse2-Cas6-Cas3-iCA
Plasmid#134923PurposeComponents for genome editing in mammalian cells with pPV-EF1a-2xNLS-Cas7-Cas5-Cse1-iCA and pBS-U6-crRNA-targeted. This plasmid was optimized for iPS cells and coexpresses mCherry protein.DepositorInsertCascade factors (Cse2(Cas11), Cas3, Cas6) with bpNLS
ExpressionMammalianPromoterEF1aAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only