-
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprTagsExpressionMutationPromoterJ23119Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprTagsExpressionMutationPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L2
Plasmid#113735PurposeGateway entry vector containing attL1 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRTagsExpressionMammalianMutationnot applicablePromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 2
Plasmid#70657PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprTagsExpressionMutationPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 2
Plasmid#59975PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralTagsExpressionMutationPromoterAvailable sinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 EB1 shRNA #1
Plasmid#37928DepositorInsertEB1 shRNA #1 (MAPRE1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterhuman U6Available sinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorInsertTFAP2C (TFAP2C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec6
Plasmid#31118DepositorInsertSec6 shRNA (EXOC3 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup88-HindIII
Plasmid#87329PurposeTo express shRNA against human Nup88DepositorInsertshRNA against human Nup88
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH118-17
Plasmid#91727PurposeNAT-marked C. albicans URA3-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.DepositorInsertNAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2
UseTagsExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCJ1021
Plasmid#228761PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Ift88. Use for disruption of mouse Ift88 in cultured cells.DepositorInsertIft88 gRNAs (Ift88 Mouse)
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterhU6Available sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorInsertPMR1 gRNA (PMR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianMutationPromoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only