We narrowed to 6,098 results for: tTA
-
Plasmid#187220PurposeExpresses Eco1 ncRNA v35 (long a1/a2) and Eco1 ncRNA v35 (long a1/a2, barcode 6) from promoters pSalTTC and pTet*, respectivelyDepositorInsertRetron Eco1 ncRNA v35 (long a1/a2); Retron Eco1 ncRNA v35 (long a1/a2, barcode 6)
ExpressionBacterialPromoterA: pSalTTC; B: pTet*Available SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBK.010
Plasmid#187210PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 2 [GCT-AGC]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 2 [GCT-AGC])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH664
Plasmid#169608PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven rtTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven rtTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ash1-5p
Plasmid#169712PurposeBacterial Expression of truncated yeast Ash1 including encoding amino acids 420-480 with phosphorylation sites 429 and 470 removedDepositorInsertAsh1 (ASH1 Budding Yeast)
Tags6xHisExpressionBacterialMutationTruncation including encoding amino acids 420-480…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
THI ONLY pALD4 T-
Plasmid#161497PurposeNon activation and non targeting control for CRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_VP64_SV40NLS_pGAP_THI11_T-_gRNA_MS2DepositorInsertsdCAS9
MS2 (non activation control NAC)
gRNA (Non targeting control NTC)
ExpressionYeastPromoterpALD4, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi1
Plasmid#59614PurposeExpression of shRNA against human ATF7IPDepositorAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-sgE1TSS-short-3'box
Plasmid#92165PurposesgRNA expression vector for Evx1as RNA tethering assayDepositorInsertEvx1as short isoform
UseCRISPRPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pDest17_MAX
Plasmid#234044PurposeBacterial expression of N-terminally 6His-tagged MAX; includes TEV cleavage siteDepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-TeLC-P2A-dTomato
Plasmid#159102PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.DepositorInsertTeLC-P2A-NLS-dTomato
UseAAVPromoterhSynapsinAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD47-T2A-GFP
Plasmid#205449Purposelentiviral plasmid for expression of mouse CD47DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2-10xUAS-Voltron
Plasmid#119039PurposeUAS-driven expresion of Voltron in zebrafishDepositorInsertVoltron
UseZebrafish expressionPromoterE1bAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol2-elavl3-Voltron-ST
Plasmid#119038PurposePan neuronal expression of soma-localized Voltron in zebrafishDepositorInsertVoltron-ST
UseZebrafish expressionPromoterelavl3Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-hCD47-T2A-GFP
Plasmid#205458Purposelentiviral plasmid for expression of human CD47DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2-10xUAS-Voltron-ST
Plasmid#119040PurposeUAS-driven expresion of soma-localized Voltron in zebrafishDepositorInsertVoltron-ST
UseZebrafish expressionPromoterE1bAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD)
Plasmid#204619PurposeExpression vector of Cascade and Cas3. Puromycin selectable.DepositorInsertCas7, Cas5, Cas8, Cas11, Cas6, and Cas3
UseCRISPRTagsEach protein has C- and N-terminal SV40 NLSPromoterEF1aAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Tat
Plasmid#138478PurposeExpresses HIV Tat for efficient sgRNA packaging.DepositorInsertTat
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only