We narrowed to 4,622 results for: IRES
-
Plasmid#65294Purposesynchronize trafficking of EGFP-GPI from the ER (RUSH system)DepositorInsertGPI anchor
TagsEGFP and IL-2 Signal Sequence and Streptavidin Bi…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
HA-Elongin B-pcDNA3.1(+)-Zeo
Plasmid#20000DepositorInserttranscription elongation factor B (ELOB Human)
TagsHA-tagExpressionMammalianMutationwild typeAvailable SinceApril 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ZNF598-TEV-3xFLAG
Plasmid#105690PurposeExpresses C terminally 3xFLAG tagged ZNF598 proteinDepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1a-MYC-IRES-CRE
Plasmid#252085PurposeStably expresses human MYC, IRES, and CRE from the EF1a promoter.DepositorAvailable SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTL53_pyCAG-s36GFPmNG-IRES-mCherry3NLS-polyA
Plasmid#223545PurposeMinimal PUFFFIN cassette with s36GFP-mNeonGreen and mCherry-3NLS, separated by IRES, strong constitutive promoter CAG, no insulation or mammalian selection geneDepositorInserts36GFP-mNeonGreen, mCherry-3NLS
ExpressionMammalianPromoterCAGAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PV-NES-GFP
Plasmid#17301DepositorAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
Ii-Str_ssSBP-EGFP
Plasmid#65277Purposeto synchronize transport of secretory soluble GFP from the ER (RUSH system)DepositorInsertEGFP
TagsIL-2 signal sequence and Streptavidin Binding Pr…ExpressionMammalianPromoterCMVAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBRPyCAG-hKlf2-DsRed-Ip
Plasmid#26277DepositorInsertKlf2 (KLF2 Human)
ExpressionMammalianAvailable SinceNov. 12, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCS2 GFP-GSK3-MAPK
Plasmid#29689PurposeGFP reporter protein fused to three GSK3 phosphorylation sitesDepositorInsertGFP glycogen synthase kinase 3 recognition site primed by MAPK
TagsFlag and Flag-EGFPExpressionMammalianMutationrecognition sites only, and E3 ligase sitePromoterSP6Available SinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCS2 CA-LRP6-GFP
Plasmid#29682DepositorInsertLDL-receptor related protein 6 (LRP6 Human)
TagsGFPExpressionMammalianMutationextracellular region deletedAvailable SinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_SBP-mCherry-Golgin84
Plasmid#65304Purposesynchronize trafficking of Golgin-84 from the ER (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Stat1 alpha Y701F Flag pRc/CMV
Plasmid#8702DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pE2F3-donor
Plasmid#113809PurposeCRISPR donor plasmid to tag human transcription factor E2F3 with GFPDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF778-donor
Plasmid#112379PurposeCRISPR donor plasmid to tag human transcription factor ZNF778 with GFPDepositorInsertZNF778 homology arms flanking EGFP-IRES-Neo cassette (ZNF778 Human)
UseCRISPRMutationrs4785627,rs28415940,rs9921361,rs28638280,rs60437…Available SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF215-donor
Plasmid#113804PurposeCRISPR donor plasmid to tag human transcription factor ZNF215 with GFPDepositorInsertZNF215 homology arms flanking EGFP-IRES-Neo cassette (ZNF215 Human)
UseCRISPRMutationrs2239733, rs2239732, hg38:11:6956348:T>G, rs1…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGLIS3-donor
Plasmid#113812PurposeCRISPR donor plasmid to tag human transcription factor GLIS3 with GFPDepositorInsertGLIS3 homology arms flanking EGFP-IRES-Neo cassette (GLIS3 Human)
UseCRISPRMutationrs10118031, rs10973702, rs912257Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFP3-donor
Plasmid#113811PurposeCRISPR donor plasmid to tag human transcription factor ZFP3 with GFPDepositorInsertZFP3 homology arms flanking EGFP-IRES-Neo cassette (ZFP3 Human)
UseCRISPRMutationrs11313283Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only