We narrowed to 6,953 results for: crispr cas9 plasmids

#192656

A plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomato

Jeffrey Miner

Omachi et al PLoS One. 2022 Jun 28;17(6):e0270008. do

Dec. 15, 2022

Academic Institutions and Nonprofits only

#85413

hU6 driven sgRNA vector with 2xMS2 vectors with puro selectable marker

Michael Bassik

Hess et al Nat Methods. 2016 Oct 31. doi: 10.1038/n

Dec. 15, 2016

Academic Institutions and Nonprofits only

#192658

A plasmid encoding TRE3G sgRNA and TRE3G-promoter-TdTomato

Jeffrey Miner

Omachi et al PLoS One. 2022 Jun 28;17(6):e0270008. do

Jan. 5, 2023

Academic Institutions and Nonprofits only

#210212

An empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.

Albert Jeltsch

Rajaram et al Methods Mol Biol. 2024;2842:179-192. doi

Dec. 5, 2023

Academic Institutions and Nonprofits only

#207770

Expresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.

Laurence Pelletier

Philip et al EMBO J. 2024 Dec 12. doi: 10.1038/s44318

Nov. 29, 2023

Academic Institutions and Nonprofits only

#227303

Expresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.

Laurence Pelletier

Philip et al EMBO J. 2024 Dec 12. doi: 10.1038/s44318

Nov. 8, 2024

Academic Institutions and Nonprofits only

#171031

CRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)

Thomas Cech

Long et al Nat Genet. 2020 Sep;52(9):931-938. doi:

Aug. 26, 2021

Academic Institutions and Nonprofits only

#244242

CRISPR/Cas9 donor plasmid to tag mouse histone H3.1 with Halo tag

Kazuhiro Maeshima

Minami et al Sci Adv. 2025 Mar 28;11(13):eadu8400. do

Oct. 2, 2025

Academic Institutions and Nonprofits only

#136940

NHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4

Jeremy Stark

Bhargava et al J Biol Chem. 2019 Nov 21. pii: RA119.010

Feb. 14, 2020

Academic Institutions and Nonprofits only

#103008

S. cerevisiae Episomal plasmid harboring Fncpf1 under the control of TDH3p

Jean-Marc Daran

Swiat et al Nucleic Acids Res. 2017 Dec 1;45(21):125

Dec. 1, 2017

Academic Institutions and Nonprofits only