We narrowed to 2,443 results for: CLU
-
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP HAT
Plasmid#179547Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_7
Plasmid#60293PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SK
Plasmid#136577PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, Klf4DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET11a_3xFlag-nsp10 (SARS-CoV-2)
Plasmid#169157PurposeTo express SARS-CoV-2 nsp10 in E. coliDepositorInsert3xFlag-nsp5CS[VRLQ]-nsp10 (ORF1ab SARS-CoV-2, Synthetic)
Tags3xFlag and nsp5CS[VRLQ]: predicted nsp5 protease …ExpressionBacterialMutationCodon optimised for E. coliPromoterT7Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_25
Plasmid#60305PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_9
Plasmid#60295PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KS
Plasmid#136617PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_29
Plasmid#60309PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_31
Plasmid#60310PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_21
Plasmid#60296PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_19
Plasmid#60302PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only