We narrowed to 5,455 results for: IRES
-
Plasmid#183744PurposeExpresses Ki67 (shuffled Nterm)-mNeonGreenDepositorInsertMKI67 (shuffled Nterm) (MKI67 Human)
TagsmNeonGreenExpressionBacterial and MammalianMutationCD domain with shuffled 4 fragments fused to the …PromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS507-pCDest2-noAcr-mTagBFP2-IRES
Plasmid#85748PurposeExpresses mTagBFP2 only; used as a controlDepositorInsertmTagBFP2
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX-MAPKAP1Del-FHH-IRES-Puro
Plasmid#120706PurposeExpresses MAPKAP1 Truncation-Flag-HA-6xHIS fusion protein in mammalian cells & for virus productionDepositorInsertMAPKAP1 Isoform 1
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationDeleted amino acids 193-522PromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EVA1ext-hFcIgG3-IRES-YFP
Plasmid#64926PurposeTo express extracellular portion of EVA1 (mouse) fused with human Fc(IgG3)DepositorUseRetroviralTagsIRES-YFPExpressionMammalianPromoterLTRAvailable SinceJune 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-bat-Caspase-4
Plasmid#183377PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B IRES GFP
Plasmid#133817PurposeEncodes the C2B domain of synaptotagmin 1 for viral expressionDepositorAvailable SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαWT-IRES-EGFP
Plasmid#183456PurposeReplacement of endogenous rat PKA-RIIα subunits with wild-type RIIαDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
hPlekhm1-N/pIRES puro Glue (M1-A497)
Plasmid#73454PurposeExpress human N-terminal part (M1-A497) Plekhm1 in mammalian cellsDepositorAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-pax3a-kcnj13-IRES-EGFP
Plasmid#164950PurposeTol2 construct: pax3a-5.4k promoter driven zebrafish kcnj13 fused with EGFP and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoterpax3a promoter -5.4kAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcnj13-IRES-EGFP
Plasmid#164941PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj13 and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoteractinb (actb2) promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingMutationDrd1a coding sequence followed by IRES-tauGFP ACNFAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
HD201: pMVP (L3-L2) IRES-eGFP + polyA
Plasmid#121747PurposepMVP L3-L2 entry plasmid, contains IRES2-eGFP+ polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of eGFP reporter from IRES sequence.DepositorInsertIRES2-eGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXCX-sGFAP-LMO-IRES-tdTomato
Plasmid#178312PurposeExpress the bacterial lactate 2-monooxygenase (LMO) enzyme in astrocytesDepositorInsertLactate 2-monooxygenase
UseAdenoviralTagstdTomatoExpressionMammalianPromotersGFAPAvailable SinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C S222A
Plasmid#89716PurposeRetroviral gene expression vector for MEF2C-S222A expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-S75F
Plasmid#24580DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationserine 75 changed to phenylalanine (codon TCT cha…Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/UAA-mEGFP-IRES-mCherry
Plasmid#49234PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-Polß(WT)--IRES-hyg
Plasmid#128667Purposemammalian expression of Flag-Polß(WT) protein with hygromycin selectionDepositorInsertPolB (POLB Human)
UseLentiviralTagsFlagExpressionMammalianMutationWild typePromoterCMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-MCS-hPOT1_K90E_IRES-blast
Plasmid#166412Purposeexpress hPOT1 K90E in mammalian cellsDepositorInserthPOT1 K90E (POT1 Human)
UseLentiviralTagsMYCExpressionMammalianMutationK90EPromoterEF-1aAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only