We narrowed to 1,204 results for: poli
-
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUW-C-prM-E-NS1
Plasmid#175281Purposelentiviral vector mediating bicistronic expression of the 4 genes of YFV-17D (C-prM-E-NS1) and EGFP.DepositorInsertC-prM-E-NS1 and EGFP (POLY Yellow fever virus strain 17D)
UseLentiviralTagsIRES EGFPExpressionMutationPromoterhuman ubiquitin CAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)ExpressionMutationPromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1NF
Plasmid#175279PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17DDepositorInsertNS1 (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromotertight TREAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-NS1
Plasmid#175273PurposeAAV vector mediating Cre-depenent expression of NS1 gene of YFV-17DDepositorInsertNonstructural protein 1 (NS1) of YFV-17D (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)ExpressionMutationPromoterbidirectional TRE promoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-C-prM-E-NS1
Plasmid#175277PurposeAAV vector mediating inducible expression of 4 genes (the C-prM-E-NS1) of YFV-17DDepositorInsertC-prM-E-NS1 (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromotertight TREAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only