We narrowed to 3,395 results for: zebrafish
-
Plasmid#135209PurposeDominate Negative zebrafish e-cadherin labelDepositorInsertCDH1
UseSynthetic BiologyAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
374 pME-ets1a
Plasmid#49000Purposefull length coding sequence for zebrafish ets1a gene in gateway middle entry vectorDepositorInsertv-ets erythroblastosis virus E26 oncogene homolog 1a (ets1 Zebrafish)
UseGateway middle entryAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pCS2z-tal1
Plasmid#164656Purposefor the synthesis of zebrafish tal1 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ptdTomato-N1-CMVL-ikk1FL(C179A)-tdTomato
Plasmid#105644PurposeZebrafish Inhibitor of kappa B kinase alpha with mutation at position 179 from cysteine to alanineDepositorInsertCMVL-ikk1FL(C179A)-tdTomato (chuk Zebrafish)
TagstdTomatoExpressionMammalianMutationCMV:ikk1FL(C178A)-tdTomatoAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3E-DysF
Plasmid#109544PurposeMultisite gateway vector for 3' tagging with DysferlinDepositorAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p3E-Dnm2a-DN
Plasmid#109572PurposeMultisite gateway vector for 3' tagging with dominant negative Dynamin2aDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-Lyzc-mCherry-Rab4 DN
Plasmid#254774PurposeNeutrophil specific Dominant Negative Rab4 in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-FL Rabep1-T2A-RFP-Caax
Plasmid#254770PurposeNeutrophil specific Full length Rabep1 in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCS2_hsPum2_dreAdar1
Plasmid#250542PurposeIn vitro transcription (SP6 promotor) or mammalian expression (CMV promotor) of human Pum2 fused to the catalytic domain of zebrafish Adar1DepositorInserthsPum2_dreAdar1 (PUM2 Synthetic)
UseSynthetic BiologyAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-FLAG3-hsAgo2EF-DY
Plasmid#221723PurposeExpression of human Ago2 with E637D and F666Y mutations and N-terminal 3xFLAG tag in zebrafish embryos.DepositorInserthsAgo2EF-DY (AGO2 Human)
UseFish expressionTags3xFLAGMutationE637D and F666Y in active sitePromotersimian CMV IE94Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mCherry-Cenexin-S796A
Plasmid#186434PurposeExpresses mCherry Cenexin with S796A mutation in mammalian cells and zebrafish embryosDepositorInsertCenexin (ODF2 Human)
TagsmCherryExpressionMammalianMutationChanged Serine 796 to AlaninePromoterCMV IE94Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
p3E-ARF1-DN
Plasmid#109590PurposeMultisite gateway vector for 3' tagging with dominant negative ARF1DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p3E-ARF6-DN
Plasmid#109592PurposeMultisite gateway vector for 3' tagging with dominant negative ARF6DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
p3E-Lact-C2
Plasmid#109553PurposeMultisite gateway vector for 3' tagging with the C-terminal domain from cow (Bos taurus) milk fat globue EGF-factor 8 protein (MFGE8). Binds phosphatidylserine (PS)DepositorInsertthe C-terminal domain from cow (Bos taurus) milk fat globue EGF-factor 8 protein (MFGE8).
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
neurod1:cre; cmlc2:EGFP
Plasmid#173480Purposecre is driven by -5kb neurod1 promoter. The vector contain a cmlc2:EGFP makerDepositorInsertCre
UseZebrafish expressionAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
neurod1:Gal4; cmlc2:EGFP
Plasmid#173478PurposeGal4 is driven by -5kb neurod1 promoter. The vector contains a cmlc2:EGFP markerDepositorInsertGal4
UseZebrafish expressionAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
Tg(Sox17::EMTB-3xGFP)
Plasmid#221190PurposeTo specifically label microtubules (MTs) in Kupffer's Vesicle (KV)DepositorInsertEnsconsin Microtubule-Binding Protein (MAP7 Human)
UseZebrafishTags3 EGFPMutationMicrotubule binding-domain of ensconsin (A.A. 18…PromoterSox17Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1b in pT3TS-Dest
Plasmid#194295PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1b from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LACDepositorInsertcavin1b (cavin1b Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf ctnna1L344P
Plasmid#185407PurposeZebrafish ctnna1 bearing a point mutation in the vinculin binding site. For in vitro transcription (SP6) or expression through CMVDepositorInsertctnna1 (ctnna1 Zebrafish)
UseIn vitro synthesis of mrnaExpressionMammalianMutationchanged Leucine 344 to ProlineAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCav1
Plasmid#194290PurposeMultisite gateway entry clone for expression of codon optimised zebrafish caveolin1 with fusion tag at the N-terminus. Parton lab clone KRTDepositorInsertcaveolin1 (cav1.S Frog)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CmCitrine Lck w/ NosUTRs
Plasmid#66785Purposeexpression of fluorescent membranes in sea urchin primordial germ cellsDepositorInsertLck (LCK Human)
UseSea urchin, zebrafish, xenopusTags3' UTR from sea urchin Nanos, 5' UTR fr…MutationTandem repeat of LCK the N-terminal membrane targ…PromoterT7Available SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-delta5_2 Rabep1-T2A-RFP-Caax
Plasmid#254768PurposeNeutrophil specific Rabep1 truncation lacking rab5 binding domain in tol2 backboneDepositorAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-mCherry-CAAX
Plasmid#254787PurposemCherry C-terminally tagged with the CaaX sequence. Neutrophil membrane control.DepositorInsertmCherry-CAAX
UseZebrafish expressionPromoterLyzcAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-U6ac-Praf2-guides
Plasmid#254765PurposePraf2 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-delta4_2 Rabep1-T2A-RFP-Caax
Plasmid#254769PurposeNeutrophil specific Rabep1 truncation lacking rab4 binding domain in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-Lyzc-mCherry-Rab11 DN
Plasmid#254775PurposeNeutrophil specific Dominant Negative Rab11 in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-TagRFP-T-EEA1
Plasmid#254776PurposeNeutrophil specific Early Endosome Antigen 1 expression in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Rabep1-1-guides
Plasmid#254761PurposeRabep1 gRNAs for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Arhgap20-guides
Plasmid#254763PurposeArhgap20 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Vamp8-guides
Plasmid#254764PurposeVamp8 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDD3248 pCS2-mtagBFP2-p2a-NES-arrb2a-(ENLYFQ/S)x3-SV40NLS-sfCherry3C(1-10)
Plasmid#251770PurposeBlue fluorescent protein-tagged TEVp substrate (three-peat motif) for fluorescent protein reconstitution assayDepositorInsertarrestin, beta 2a (arrb2a Zebrafish)
TagsNLS (SV40), sfCherry3C large fragment and mTagBFP…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_Del4UC1_EGFP
Plasmid#229691PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish mutant Cavin1 (Del4UC1)DepositorUseLentiviralTagsEGFPMutationDel4UC1PromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only