We narrowed to 15,270 results for: grn
-
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AksgRNA
Plasmid#121955PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAkCas12b single chimeric gRNA
ExpressionMammalianAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiGuidPuro-hTP73_sgRNA-1
Plasmid#88855PurposeCRISPR KO of Trp73DepositorInsertTrp73
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA2
Plasmid#92313PurposeCRISPR-GFP-gRNA for cutting WT1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertWT1 (WT1 Human)
TagsCRISPR GFPExpressionMammalianPromoterU6Available sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3041(gRNA X-3)
Plasmid#73283PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3044(gRNA XI-2)
Plasmid#73286PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Construct 10 - U6p_40nt_stgRNA
Plasmid#81249PurposeExpresses 40nt stgRNADepositorPublicationInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12
Plasmid#61079PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA_hIRF1 promoter #12 (IRF1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Bsn-GFP KI
Plasmid#139665PurposeEndogenous tagging of Bassoon: C-terminal (amino acid position: F3938)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_AXP
Plasmid#84608PurposeIntroduces DSB at AXP locus in Y. lipolyticaDepositorPublicationInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available sinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPRyl_A08
Plasmid#84610PurposeIntroduces DSB at A08 locus in Y. lipolyticaDepositorPublicationInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available sinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pORANGE GFP-RAB11a KI
Plasmid#131499PurposeEndogenous tagging of RAB11: N-terminal (amino acid position: before startcodon)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9.EF1a-BFP.sgLMNA
Plasmid#98971PurposeCas9 Homologous Recombination Reporter. SpCas9 and a sgRNA targeting LMNA. TagBFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA sgRNA and spCas9
ExpressionMammalianAvailable sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by