We narrowed to 4,407 results for: crispr c plasmids
-
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6e
Plasmid#207855PurposeMammalian expression of PE6e prime editorDepositorInsertPE6e
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationCas9(H840A, K918A, K775R)Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-PEmaxRNaseHtrunc
Plasmid#207858PurposeMammalian expression of PEmaxDRNaseH prime editorDepositorInsertPEmaxDRNaseH
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrtAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6f
Plasmid#207856PurposeMammalian expression of PE6f prime editorDepositorInsertPE6f
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationCas9(H840A, E471K, H99R, I632V, H721Y, D645N, K91…Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-PE6g
Plasmid#207857PurposeMammalian expression of PE6g prime editorDepositorInsertPE6g
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationCas9(H840A, E471K, H99R, I632V, H721Y, R654C, D64…Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRIS
Plasmid#120424PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3, IS5, and IS150.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3, IS150
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable sinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBLO1811_arC9_noNLS_human
Plasmid#74494PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/o NLS and a sgRNADepositorInsertarC9
UseCRISPRTagst2a mCherry (C-terminal on insert)ExpressionMammalianAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-henAsCas12a(E174R/S542R/K548R)-NLS(nucleoplasmin)-6xHis (AAS1885)
Plasmid#114072PurposeT7 promoter bacterial expression plasmid for human codon optimized enAsCas12a(E174R/S542R/K548R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized enAsCas12a (E174R/S542R/K548R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, and K548RAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVi U6_gRNA CMV_SadCas9-KRAB
Plasmid#214609PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassetteDepositorInsertsgRNA
SadCas9
UseAAVTagsNP NLS and SV40 NLSExpressionMammalianMutationD10A, N580APromoterCMV and U6Available sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable sinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFTK061
Plasmid#171333PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertSpCas9 (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-henAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nucleoplasmin)-6xHis (AAS1935)
Plasmid#114073PurposeT7 promoter bacterial expression plasmid for human codon optimized enAsCas12a-HF1(E174R/N282A/S542R/K548R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized enAsCas12a-HF1 (E174R/N282A/S542R/K548R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548R and N282AAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJAK184.tetR.PT5-3.dCas9
Plasmid#232482Purposeoptimized ahTet inducible dCas9 for insertion into C. difficile genomeDepositorInsertCatalytically dead mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system
UseCRISPRExpressionBacterialPromoterTetR-PT5-3Available sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIW447-CRISPR XYL2
Plasmid#98906PurposeK. marxianus CRISPR Plasmid for XYL2 editingDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastAvailable sinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hMYC
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable sinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-T7-hAcrVA1-NLS(sv40) (BPK5050)
Plasmid#115136PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS279
Plasmid#73729PurposeSapTrap FLP-on C-terminal connector donor plasmidDepositorInsertC-terminal FLP-on
UseCRISPRAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV2-U6gRNA5(sgCXCR1-2)-PGKpuro2ABFP-W
Plasmid#252916PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable sinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-1)-PGKpuro2ABFP-W
Plasmid#252915PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable sinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET28b-SpRY-His
Plasmid#179320PurposePlasmid for bacterial expression and purification of SpRY-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpRY
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only