We narrowed to 4,446 results for: gca
-
Plasmid#75899Purpose3rd generation lentiviral gRNA plasmid targeting human SBK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TNIK gRNA (BRDN0001146101)
Plasmid#75850Purpose3rd generation lentiviral gRNA plasmid targeting human TNIKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK1 gRNA (BRDN0001148208)
Plasmid#75514Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgGLDC_1
Plasmid#72886PurposeCRISPR-Cas9 induced gene disruptionDepositorInsertsgGLDC
UseLentiviralPromoterCMVAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA6
Plasmid#59310PurposeKnockdown of human FOXH1DepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-5xE-box
Plasmid#206841PurposeThe plasmid contains a 312 bp DNA fragment that contained 5 canonical E-boxes (GCCACGTGCA) spaced by 50 nucleotides and cloned into pGL4.23[luc2/minP] (XhoI/HindIII).DepositorInsert5x E-box ((GCCACGTGCA)
UseLuciferaseAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001144754)
Plasmid#75602Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA3
Plasmid#166915PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts2
Plasmid#115854PurposeAGO2 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only