We narrowed to 27,164 results for: RON
-
Plasmid#191321PurposeExpresses fuorescently labeled beta tubulin to allow photoactivation of microtubule patches with very little UV lightDepositorInsertTUBB2a-Dronpa (Tubb2a Mouse)
ExpressionMammalianAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CBX1mut-Dronpa
Plasmid#138250PurposeTriple-mutant CBX1 chromodomain (residues 20-73) tagged with reversibly switchable FP Dronpa. Mutations V3E/K6E/D40S correspond to positions V22/K25/D59 in full-length CBX1.DepositorInsertCBX1mut-Dronpa
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
IgH intron enhancer
Plasmid#127247PurposeTo maximize gene expression in B cellsDepositorInsertheavy chain enhancer
ExpressionMammalianAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Alpha-0 Dronpa
Plasmid#44193DepositorInsertG protein alpha 0 (Gnao1 Rat)
TagsDronpaExpressionMammalianMutationIntroduced KpnI and SpeI sites between 92nd and 9…PromoterCMVAvailable SinceApril 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Iron Insensitive Control Construct 2
Plasmid#243007PurposeIron Insensitive Control Construct under the same expression promoter used in IronFistDepositorInsertsmNeonGreen
T2A
mCherry
UseGatewayExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWALIUM-intron 3x UAS attB
Plasmid#206360Purposeincludes two standard UAS cassettes and one UAS cassette designed to co-express shRNAs/shRNA clusters and prodein coding sequencesDepositorTypeEmpty backboneExpressionInsectAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCMV-intron myc Rab1aWT
Plasmid#46776Purposeexpression of WT Rab1a in mammalian cellsDepositorAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-GFP
Plasmid#59170PurposeAAV-mediated expression of Chronos-GFP under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, and AAV5InsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/intron/GFP
Plasmid#113547PurposeMammalian expression plasmid that can be used with the Flp-In T-REx system.DepositorInsertGFP
TagsGFPExpressionMammalianAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-plasma in pMAX
Plasmid#120401Purposeenables eukaryotic expression of human plasma fibronectinDepositorAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLZ29 (pCFJ151_Peft-3_degron_EmGFP_unc-54 3'UTR)
Plasmid#71719PurposeExpressing a GFP-tagged degron in the soma of C. elegansDepositorInsertauxin-responsive protein IAA17 (AXR3 Mustard Weed)
TagsEmGFPExpressionWormMutationminimal degron sequence (71-114aa) with start cod…Promotereef-1A.1 (eft-3)Available SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDA in pMAX
Plasmid#120402Purposeenables eukaryotic expression of human EDA (or EIIIA) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOpen-lambda red operon
Plasmid#165521PurposeOperon containing Exo, Bet, and Gam. To use the lambda red recombineering system to modify your target DNA.DepositorInsertlambda red operon
UseSynthetic BiologyAvailable SinceAug. 3, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PyronicSF-mRuby2/pBI-CMV1
Plasmid#124830PurposeHighly resposive GFP-based pyruvate nanosensor.DepositorInsertsPyronicSF
mRuby2
ExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Chronos(M140T)-mRuby2-ST
Plasmid#109129PurposeModified cation channelrhodopsin Chronos fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChronos(M140T)-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-nsp3-c3xFLAG
Plasmid#215696PurposeProduces the Chikungunya virus nonstructural protein 3 with a c-terminal 3xFLAG tagDepositorInsertCHIKV nsp3
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PP_072_pAAV_hSyn_DIO-LR-Voltron2-P2A-LR-CheRiff-HA
Plasmid#230988PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized optopatch for neuronal dendrites
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only