-
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVTagsExpressionMutationCas9 D10APromoterCbhAvailable sinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_219
Plasmid#164559PurposeLentiviral vector that encodes two sgRNA expression cassettes. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsFirst sgRNA cassette
Second sgRNA cassette
UseCRISPR and Lentiviral; Dual sgrnaTagsExpressionMammalianMutationPromoterHuman U6 and Mouse U6Available sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
Plasmid#190112PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFPDepositorInsertsMMLV-RT(dRH)
U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
UseAAVTagsbpNLS and bpNLS-P2A-eGFPExpressionMutationmutations from RT in PE2 and truncation of RNAse …PromoterEFS and U6, H1Available sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6gRNA1-U6gRNA2-TnT-Cre
Plasmid#87682PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.DepositorInsertsgRNA1
gRNA2
Cre
UseAAVTagsExpressionMutationPromoterU6 and cTnTAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-RfxCas13d-SV40pA_U6-BbsI-DR_CMV-mCherry-BGHpA
Plasmid#171380PurposeExpression vector for encoding a human codon-optimized RfxCas13d driven by CMV promoter,mCherry driven by CMV promoter and U6-driven crRNAs cloning site.DepositorInserthumanized RfxCas13d
UseTagsHAExpressionMammalianMutationPromoterCMV, U6Available sinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCKO
Plasmid#73311PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BfuAI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV p2GM AMPK alpha2hp1 alpha1hp1
Plasmid#89492PurposeshRNA against AMPK alpha2 and alpha1 in mouse/human to knock down protein expressionDepositorInsert2 hairpins against mouse/human AMPKalpha1 and alpha2
UseRetroviralTagsExpressionMammalianMutationPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available sinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only