Skip to main content

We narrowed to 2,123 results for: PAM

Showing: 1461 - 1480 of 2123 results
  1. pLD-puro-Cc-CR-PARK7H126A-VA

    Plasmid
    #115190
    Purpose
    Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
    Depositor
    Insert
    CR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
    Use
    Lentiviral
    Tags
    Versatile affinity tag (2XStreptactin II-6XHis-3X…
    Mutation
    c.150G>A (silent when translated to protein, c…
    Promoter
    CMV
    Available Since
    March 26, 2021
    Availability
    Academic Institutions and Nonprofits only
  2. pLD-puro-Cc-CR-PARK7E163K-VA

    Plasmid
    #115191
    Purpose
    Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
    Depositor
    Insert
    CR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
    Use
    Lentiviral
    Tags
    Versatile affinity tag (2XStreptactin II-6XHis-3X…
    Mutation
    c.150G>A (silent when translated to protein, c…
    Promoter
    CMV
    Available Since
    March 26, 2021
    Availability
    Academic Institutions and Nonprofits only
  3. pPS293

    Plasmid
    #8851
    Depositor
    Insert
    GAL1 promoter (GAL1 Budding Yeast)
    Expression
    Yeast
    Available Since
    Aug. 3, 2005
    Availability
    Academic Institutions and Nonprofits only
  4. p35S:TN3-YFPn

    Plasmid
    #102407
    Purpose
    split YFP. Plant expression of p35S:TN3-YFPn
    Depositor
    Insert
    TN3
    Tags
    YFPn
    Expression
    Plant
    Promoter
    35S
    Available Since
    Jan. 23, 2018
    Availability
    Academic Institutions and Nonprofits only
  5. pcDNA3.1-hDAT

    Plasmid
    #32810
    Depositor
    Insert
    DAT (SLC6A3 Human)
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Dec. 5, 2011
    Availability
    Academic Institutions and Nonprofits only
  6. OTV-dDAT

    Plasmid
    #32812
    Depositor
    Insert
    dDAT (DAT Fly)
    Use
    Oocyte expression
    Promoter
    T7
    Available Since
    Dec. 5, 2011
    Availability
    Academic Institutions and Nonprofits only
  7. R777-E269 Hs.RASSF9

    Plasmid
    #70553
    Purpose
    Gateway ORF clone of human RASSF9 [NM_005447.3] with stop codon (for native or N-terminal fusions)
    Depositor
    Insert
    RASSF9 (RASSF9 Human)
    Use
    Gateway entry clone
    Available Since
    March 1, 2016
    Availability
    Academic Institutions and Nonprofits only
  8. R777-E270 Hs.RASSF9-nostop

    Plasmid
    #70554
    Purpose
    Gateway ORF clone of human RASSF9 [NM_005447.3] without stop codon (for C-terminal fusions)
    Depositor
    Insert
    RASSF9 (RASSF9 Human)
    Use
    Gateway entry clone
    Available Since
    March 1, 2016
    Availability
    Academic Institutions and Nonprofits only
  9. p35S::ARA6/RabF1-YFPc

    Plasmid
    #102408
    Purpose
    split YFP. Plant expression of p35S::ARA6/RabF1-YFPc
    Depositor
    Insert
    ARA6 (ARA6 Mustard Weed)
    Tags
    YFPc
    Expression
    Plant
    Promoter
    35S
    Available Since
    Nov. 1, 2017
    Availability
    Academic Institutions and Nonprofits only
  10. pAcGP67A - murine TfR

    Plasmid
    #12392
    Depositor
    Insert
    transferrin receptor (Tfrc Mouse)
    Tags
    6X-His tag, Factor Xa cleavage site, and leader p…
    Expression
    Insect
    Mutation
    See comments section
    Available Since
    Aug. 17, 2006
    Availability
    Academic Institutions and Nonprofits only
  11. 35S:YFPc-RabG3b-DN

    Plasmid
    #102374
    Purpose
    fluorescent tagging. Plant expression of YFPc-RabG3b-DN
    Depositor
    Insert
    RabG3B (RABG3B Mustard Weed)
    Tags
    YFPc
    Expression
    Plant
    Mutation
    T22N
    Promoter
    35S
    Available Since
    Oct. 30, 2017
    Availability
    Academic Institutions and Nonprofits only
  12. 35S:YFPc-RabG3b-WT

    Plasmid
    #102373
    Purpose
    fluorescent tagging. Plant expression of YFPc-RabG3b-WT
    Depositor
    Insert
    RabG3B (RABG3B Mustard Weed)
    Tags
    YFPc
    Expression
    Plant
    Promoter
    35S
    Available Since
    Oct. 30, 2017
    Availability
    Academic Institutions and Nonprofits only
  13. 35S:YFPc-RabG3b-CA

    Plasmid
    #102372
    Purpose
    fluorescent tagging. Plant expression of YFPc-RabG3b-CA
    Depositor
    Insert
    RabG3B (RABG3B Mustard Weed)
    Tags
    YFPc
    Expression
    Plant
    Mutation
    Q67L
    Promoter
    35S
    Available Since
    Oct. 30, 2017
    Availability
    Academic Institutions and Nonprofits only
Showing: 1461 - 1480 of 2123 results