We narrowed to 15,270 results for: grn
-
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M4NS_AmpR
Plasmid#119156PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with four mismatches in the non-seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with four mismatches in the non-seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA TIAL1
UseCRISPRAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
shCTNNB1 # 1
Plasmid#42543DepositorAvailable sinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pShHELIX(Cas12k-TnsC)-sgRNA_entry (CJT113)
Plasmid#181792PurposeExpresses 3-component ShHELIX containing a Cas12k-TnsC fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTniQ, ShCas12k-ShTnsC
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9+sgRNA expression vector precursor
Plasmid#171798PurposePICASSO: Library expression vector precursor for paired dCas9+sgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterpLtetOAvailable sinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_deltaC55G-hutRNApro_BsmBIplch-sgRNA_14nt Buffer_deltaC55G-hutRNApro_SV40polyA
Plasmid#124542PurposeCloning vector for tRNA-released sgRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdeltaC55G-hutRNApro_BsmBIplch-sgRNA_14nt Buffer_deltaC55G-hutRNApro
ExpressionMammalianMutationd11-41 C55G, d11-41 C55GPromoterMinimal ADEAvailable sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS469-pLK.O1-SpySgRNA/DTS13-Telomere
Plasmid#85715PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInserttelomere sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFD116
Plasmid#124769PurposepFD116 carries dcas9 controlled by an aTc-inducible Ptet promoter, a sgRNA controlled constitutively from PpflB S. aureus promoter to clone a guide between two BsaI sites and oriT on pLZ12 vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsPtet
dcas9
PpflB sgRNA BsaI
UseCRISPRAvailable sinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
shLacZ
Plasmid#42559DepositorInsertshLacZ
UseLentiviral and RNAiExpressionMammalianAvailable sinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCX138
Plasmid#229213PurposeCRISPR array plasmid for NOTCH2 (Spacers 25-48)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR array plasmid for NOTCH2 (Spacers 25-48)
ExpressionMammalianAvailable sinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting Ctnnb1 (Ctnnb1 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSOX9-2
Plasmid#40645DepositorPublicationAvailable sinceOct. 29, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1
Plasmid#10880DepositorPublicationAvailable sinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by