We narrowed to 4,627 results for: pcr
-
Plasmid#63892PurposeBackbone pComb3X containing PCR template for human antibody lambda light chain constant regionDepositorInserthuman antibody lambda light chain (IGLL5 Human)
UsePhage displayExpressionBacterialPromoterlacZAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCCM935
Plasmid#58202PurposeExpresses unc-22 sgRNA in C.elegans. Can be used in Co-CRISPR experiments.DepositorInsertunc-22 sgRNA
ExpressionWormPromoterU6Available SinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:mNG:3Ty
Plasmid#179798PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
A1-20B1(P004)
Plasmid#184056PurposeThis plasmid carries Yn situ preamplifier A1-20B1 sequence and is used for nickase based synthesis.DepositorInsertA1-20B1 preamplifier
UseSynthetic BiologyAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-mStayGold[E138D]
Plasmid#221049PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmStayGold[E138D]
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_GFP-T2
Plasmid#41820PurposeExpresses a guide RNA (gRNA) to target GFP (T2 target sequence) for genome engineeringDepositorInsertgRNA_GFP-T2
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-g418-mScarletI
Plasmid#179822PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmScarlet-I
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-blast-3Myc:mNG:3Myc
Plasmid#179801PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-g418-3mNG
Plasmid#179832PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3x mNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hygro-3HaloTag
Plasmid#179828PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3x HaloTag
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GBP-mCherry-kanMX6
Plasmid#89068Purposegenomic GBP-mCherry epitope C-terminal tagging in S. pombeDepositorTypeEmpty backboneUsePcr-based c-terminal taggingTagsGBP-mCherryExpressionYeastAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Myc:mNG:3Myc
Plasmid#179803PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
human PNP non-tagged
Plasmid#64199PurposeExpression of native human PNP (non-tagged)DepositorAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPL5618_pUG_MtxR
Plasmid#60929PurposePCR template vector for generating methotrexate resistance cassette.DepositorInsertDihydrofolate reductase (DHFR Human)
UseLoxp flanked deletion cassette templateMutationL22F F31SPromoterTEF1Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pPOTv6-blast-3Ty:mScarletI:3Ty
Plasmid#201090PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmScaret-I
UseUnspecifiedPromoterread throughAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN007
Plasmid#102440PurposeFor PCR amplification to create paired gRNAs to clone into Golden Gate gRNA expression vectors (e.g. pSB700 Plasmid #64046)DepositorInsert7SK paired gRNA insert
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1354
Plasmid#69490PurposeGly-Ser-4xGly linker-degron-TEV-3xFLAG with 40 bp nhr-25 homology armsDepositorInsertGSGGGG spacer-Degron-TEV protease site-3x FLAG epitope
UseCRISPR; Template to generate cassettes for -media…Available SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fret-Stop-Fret TOPO
Plasmid#22774DepositorInsertfret-STOP-fret
ExpressionMammalianAvailable SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only