We narrowed to 8,814 results for: CAG
-
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR 2xU6:gRNA pten, mitfa:Cas9
Plasmid#118845PurposeTargets ptena and ptenb and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorUseCRISPR; Tol2TagsExpressionMutationPromoterAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.TRC1.shmNsd1.1, puro
Plasmid#114446PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.1 (Nsd1 Mouse)
UseLentiviral and RNAiTagsExpressionMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-puro_Panc480-MT7
Plasmid#200941PurposeMultiplexed CRISPR array expressing 7 sgRNA in a lentiviral backboneDepositorInsertmultiplexed sgRNA array
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, EF-1aAvailable sinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt LDHA
Plasmid#209408PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertLdhA shRNA (Ldha Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA435
Plasmid#215962PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; sgCD274_v1; DR_v1 [EnAs]; sgADGRE5_v3; DR_v2; sgCD4_v1; DR_v3; sgDPP4_v1
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorInsertsgNkx2-1#1 (Nkx2-1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
UseTagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available sinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAK-1
Plasmid#210131Purposeknock out BAK in mammalian cellsDepositorInsertBcl-2 homologous antagonist/killer (BAK1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-shCasp2-IRES-GFP
Plasmid#52061Purposestable knockdown of Caspase-2 in mammalian cellsDepositorInsertCaspase-2 shRNA (CASP2 Human)
UseRetroviralTagsIRES-EGFPExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
ADK gRNA (BRDN0001146410)
Plasmid#75743Purpose3rd generation lentiviral gRNA plasmid targeting human ADKDepositorInsertADK (ADK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A30P
Plasmid#180016PurposeTransiently expressing a pegRNA to introduce SNCA-A30P mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A30P (SNCA Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tubb3gRNA-mCherry
Plasmid#87111Purposemouse Tubb3 target gRNA expression plasmid with CAGmCherryDepositorInsertMouse Tubb3 gRNA
UseCRISPRTagsExpressionMutationPromoterCAGAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Olig2 x2)
Plasmid#171101PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Olig2.DepositorInserthSpCas9 (Olig2 S. pyogenes, Mouse)
UseCRISPRTagsExpressionMutationPromoterEf1aAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.3
Plasmid#206137PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-6
Plasmid#129034Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA6 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA6 (huTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
EXOSC10 gRNA (BRDN0001149316)
Plasmid#77990Purpose3rd generation lentiviral gRNA plasmid targeting human EXOSC10DepositorInsertEXOSC10 (EXOSC10 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKS1B gRNA (BRDN0001146740)
Plasmid#77107Purpose3rd generation lentiviral gRNA plasmid targeting human CKS1BDepositorInsertCKS1B (CKS1B Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA8 gRNA (BRDN0001146550)
Plasmid#76527Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA8DepositorInsertEPHA8 (EPHA8 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113702PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV, CRISPR, and Mouse TargetingTagsKASHExpressionMutationPromoterAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1b#2/Cre
Plasmid#173574PurposeExpresses a Arid1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1b (Arid1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid2#1/Cre
Plasmid#173575PurposeExpresses a Arid2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid2 (Arid2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR mouse Il13 mutDRACH
Plasmid#207130PurposeLuciferase vector containing 3'UTR for mouse Il13 with mutated DRACH sitesDepositorInsertInterleukin 13 (Il13) 3'UTR (Il13 Mouse)
UseLuciferaseTagsExpressionMammalianMutationTGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTT…PromoterAvailable sinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-6
Plasmid#129046Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA6 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA6 (huTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUbC-EGFP-sgRNA.FOXA1/A2/A3_CRISPRi
Plasmid#216166PurposeExpress the gRNAs for the human FOXA1/A2/A3-CRISPRiDepositorInsertUseLentiviralTagsEGFPExpressionMutationPromoterphU6, ph7SK, phH1, pmU6Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 rs58692659-guide4
Plasmid#125512PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs58692659-guide4
Plasmid#125455PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only