We narrowed to 4,498 results for: 187
-
Plasmid#118711PurposeLentiviral TET-ON inducible GFP-Progerin C661S (Farnesylation mutant)DepositorInsertGFP-Progerin C661S (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationC661S farnesylation mutantPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FGFR3_K650E
Plasmid#82187PurposeGateway Donor vector containing FGFR3 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC18B1_STOP
Plasmid#161187PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC18B1 (C6orf192 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223_FTH1_WT
Plasmid#81879PurposeGateway Donor vector containing FTH1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-p53DD-IRES-HRAS(G12V)
Plasmid#233187PurposeRetroviral expression of p53DD and HRAS(G12V) (DDIR)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-BRAF-N581K
Plasmid#116187PurposeLentiviral expression of BRAF N581KDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GPR141_WT
Plasmid#81876PurposeGateway Donor vector containing GPR141 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CNBD1_WT
Plasmid#81877PurposeGateway Donor vector containing CNBD1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Anti-Calbindin [L109/62R]
Plasmid#188187PurposeMammalian Expression Plasmid of anti-Calbindin (Human). Derived from hybridoma L109/62DepositorInsertanti-Calbindin (Homo sapiens) recombinant mouse monoclonal antibody (CALB1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based tension sensor)
Plasmid#118717PurposeThe donor (YPet(short)) only control for the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based tension sensor)
Plasmid#118719PurposeThe acceptor (mCherry) only control for the F40-based human desmoplakin II tension sensor can be co-expressed with the donor (YPet(short)) only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II-[YPet(short)(Y67G)-F40-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)(Y67G)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 TCF7L2 TSS-guide4
Plasmid#118187PurposeCRISPR-mediated activation of TCF7L2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_dTomato_nlsdTomato
Plasmid#218792PurposeAAV construct with dTomato driven by Lamp5 interneuron-targeting enhancer. Alias: pAAV_WDL0003_dTomato_nlsdTomatoDepositorHas ServiceAAV PHP.eB and AAV1InsertdTomato_P2A_nls.dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1388
Plasmid#29187PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only