We narrowed to 2,490 results for: Cre expression vector
-
Plasmid#74864PurposeGateway cloning compatible binary vector for C-terminal fusion with GST (no promoter).DepositorTypeEmpty backboneExpressionPlantAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pSTARR-seq_fly-RpS12
Plasmid#71504PurposeflySTARR-seq screening vector with RpS12 core promoterDepositorTypeEmpty backboneUseFlystarr-seq screening vectorTagssgGFP (SuperGlo, Qbiogene, Inc)ExpressionInsectAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
mKate2-P2A-APEX2-2xML1N(7Q)
Plasmid#67666PurposeMammalian expression vector driving APEX2-ML1N (Mouse 2xML1N domain (mutant version), [marks PI(3,5)P2] fused to EM peroxidase marker). Also contains bicistronially expressed cytoplasmic red reporter.DepositorInsertmKate2-P2A-APEX2-ML1Nmut*2
ExpressionMammalianPromoterCMVAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/CGA-mEGFP-IRES-mCherry
Plasmid#49224PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMA3383
Plasmid#46875PurposeA retroviral vector for the constitutive expression of soluble guanylate cyclase1 beta3DepositorAvailable SinceAug. 13, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPTK021-7-PARS
Plasmid#84990PurposeType 7, Pichia autonomously replicating sequenceDepositorInsertPichia autonomously replicating sequence
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV EF1-alpha-FLEX_hM3D(Gq)-HA-WPRE3-SV40pA
Plasmid#240285PurposeGq-coupled hM3D DREADD under the control of EF1a promoter that will express in the presence of CreDepositorInsertGq-coupled hM3D DREADD
UseAAVTagsHAPromoterEF1AAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cytERM-SUNTAG-MS2
Plasmid#247298PurposeMammalian expression of an ER-specific SUNTAG reporter; piggyBac vector to express cytERM-SUNTAG MS2DepositorInsertytERM-SUNTAG-MS2
ExpressionMammalianAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLPC-JAG1-mVenus
Plasmid#171170PurposeRetroviral vector for CMV promoter driven expression of JAG1 (Notch pathway) fused to mVenus fluorescent protein (to be used in conjunction with Phoenix packaging cells).DepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-flex-iGluSnFR4f-PDGFR-WPRE
Plasmid#234448PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC3A
Plasmid#209040PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC3A is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC3A-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3
Plasmid#214922Purposeexpression vector control - contitutive expression of mClover3 aloneDepositorInsertmClover3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS405-FlagPEN2/PS1wt
Plasmid#207803PurposeYeast integrative vector for expression of FlagPEN2 and Presenilin 1DepositorInsertGamma-secretase subunits PEN-2 and presenilin1 wt
ExpressionYeastAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS402-nicastrin/APH-1a-HA
Plasmid#207804PurposeYeast integrative vector for expression of Nicastrin and APH-1a-HADepositorInsertGamma-secretase subunits nicastrin and Aph1a
ExpressionYeastAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
GreenT-EC - GPI
Plasmid#193946PurposeMammalian expression vector for a low affinity calcium indicator exposed to the cell surfaceDepositorInsertGreenT-EC
TagsGPI-anchor and Igk_secretion - HA-FlagExpressionMammalianAvailable SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-tdTomato-WPRE
Plasmid#202610PurposeDouble floxed red fluorescent protein tdTomato in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInserttdTomato
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only