We narrowed to 11,193 results for: ENA
-
Plasmid#191062Purposebas-1 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pEY86
Plasmid#191079Purposegcy-25 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY87
Plasmid#191080Purposegcy-27 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY88
Plasmid#191081Purposeggr-1 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorInsertggr-1
ExpressionWormMutationNoneAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY90
Plasmid#191083Purposeglr-2 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY92
Plasmid#191085Purposeglr-8 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY93
Plasmid#191086Purposegpa-11 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY94
Plasmid#191087Purposegpa-13 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY95
Plasmid#191088Purposegpa-18 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY96
Plasmid#191089Purposegpa-3 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY97
Plasmid#191090Purposegpa-6 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY98
Plasmid#191091Purposegpc-1 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY237
Plasmid#184150PurposeReprogrammed short tracrRNA generator for hijacking RFP mRNA as CRISPR RNA (target site 1)DepositorInserts-tracrRNA-R1
UseSynthetic BiologyExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY251
Plasmid#184153PurposeReprogrammed short tracrRNA for hijacking mRNA of arsenic responsive gene cluster (site 2)DepositorInserts-tracrRNA-Ar2
UseSynthetic BiologyExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY283
Plasmid#184156PurposeReprogrammed short tracrRNA for hijacking mRNA of zntADepositorInserts-tracrRNA-zntA-1034
UseSynthetic BiologyExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY63
Plasmid#191060Purposeaqp-5 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY71
Plasmid#191068Purposeceh-9 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY60
Plasmid#191057Purposeacc-2 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY70
Plasmid#191067Purposeceh-48 fluorescent neural reporter driving nuclear TagRFP-T expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY66
Plasmid#191063PurposeC15C8.4 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY77
Plasmid#191072Purposedop-3 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY81
Plasmid#191076Purposeflp-32 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY75
Plasmid#191071Purposecng-3 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY67
Plasmid#191064Purposeceh-1 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY69
Plasmid#191066Purposeceh-24 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::PpsbA2*::B0032::CYP110D1 N-terminal His-Tag
Plasmid#186708PurposeN-terminal His-tagged CYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyTagsHis-Tag (6His)PromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1 N-terminal His-Tag
Plasmid#186710PurposeN-terminal His-tagged CYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyTagsHis-Tag (6His)PromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-TR-del1-40
Plasmid#180236PurposeExpresses T and R domains of Colicin E1 with N-terminal 40 residue deletion (residues 41-364)DepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T and R domains (r…PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-T-P110A
Plasmid#180237PurposeExpresses T domain of Colicin E1 (residues 1-190) with proline to alanine mutation at residue 110DepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T domain of ColE1 …PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
iLID-mRuby3-iTrkA
Plasmid#136510PurposeMammalian expression of iLID fused to mRuby3 and intracellular signaling domain of TrkA (aa 450-799)DepositorAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
iLID-mRuby3-iTrkB
Plasmid#136511PurposeMammalian expression of iLID fused to mRuby3 and intracellular signaling domain of TrkB (aa 455-822)DepositorInsertiLID mRuby3 iTrkB
ExpressionMammalianPromoterCMVAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGe1_944-1354-V5His6_D
Plasmid#146136PurposeInsect Expression of DmGe1_944-1354DepositorInsertDmGe1_944-1354 (Ge-1 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCup_C
Plasmid#146064PurposeInsect Expression of DmCupDepositorInsertDmCup (cup Fly)
ExpressionInsectMutationTwo silent mutations compared to the sequence giv…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmMe31B_1-267_C
Plasmid#146065PurposeInsect Expression of DmMe31B_1-267DepositorInsertDmMe31B_1-267 (me31B Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmMe31B_268-459_C
Plasmid#146066PurposeInsect Expression of DmMe31B_268-459DepositorInsertDmMe31B_268-459 (me31B Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmHPat_A
Plasmid#145893PurposeInsect Expression of DmHPatDepositorInsertDmHPat (Patr-1 Fly)
ExpressionInsectMutationthree silent mutations compared to the sequence g…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSMART-Ala2
Plasmid#71326PurposeNADPH dependent Alanine Dehydrogenase, Low Phosphate Dependent E. coli ExpressionDepositorInsertNADPH Alanine Dehydrogenase (ald Synthetic)
ExpressionBacterialMutationD196A, L197RPromoterinsulated waaHp from E. coliAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zfCSF3b
Plasmid#168202PurposeExpress zebrafish Csf3b, mRNA synthesisDepositorInsertCsf3b (csf3b Zebrafish)
UseVertebrate expression (zebrafish, chicken, xenopu…ExpressionMammalianAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC018.AAV
Plasmid#171146PurposeExpression of J1-BBa_J23117-mRFP and hAAVS1 scRNA on pRK2-GmR plasmidDepositorInsertshAAVS1 scRNA
J1-BBa_J23117-mRFP
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J1-BBa_J23117Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC030.306
Plasmid#171151PurposeMevalonate production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-mvaES
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zfCSF3a
Plasmid#168201PurposeExpress zebrafish Csf3a, mRNA synthesisDepositorInsertCsf3a (csf3a Zebrafish)
UseVertebrate expression (zebrafish, chicken, xenopu…ExpressionMammalianMutationDeletion of A27Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pW214-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170812PurposeLentiviral vector to co-express an sasgRNA with NLS-mScarlet-IDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Bs-4
Plasmid#163142PurposepLyGo cloning vector for a sequence of interest (LPMO) in B. subtilis. Vector encoding the BatLPMO10 signal peptide and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterPamyL-PamyQ-PcryIIIA-cryIIIAstab49Available SinceJuly 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Ec-4
Plasmid#163130PurposepLyGo cloning vector for periplasmic expression in E. coli of a sequence of interest (LPMO). Vector encoding PhoA signal peptide and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterT7Available SinceJuly 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0-NbPT5bPro
Plasmid#159416PurposeNicotiana benthamiana PT5b promoter sequence (1068 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertNbPT5b Promoter
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0-NbBCP1bPro
Plasmid#159417PurposeNicotiana benthamiana BCP1b promoter sequence (1231 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertNbBCP1b Pro
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH32 [pmyo-3::YFP-CaCyclOp(A-2x)::SL2::mCherry]
Plasmid#168168PurposeExpression of YFP-CaCyclOp(A-2x) in BWMs of C. elegansDepositorInsertYFP-CaCyclOp(A-2x)
TagsYFPExpressionWormMutationE497K and C566DAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH42 [punc-17::YFP-CaCyclOp(A-2x)::SL2::mCherry]
Plasmid#168171PurposeExpression of YFP-CaCyclOp(A-2x) in cholinergic motor neurons of C. elegansDepositorInsertYFP-CaCyclOp(A-2x)
TagsYFPExpressionWormAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only