We narrowed to 14,664 results for: sta
-
Plasmid#71501PurposeflySTARR-seq screening vector with eEF1delta core promoterDepositorTypeEmpty backboneUseFlystarr-seq screening vectorTagssgGFP (SuperGlo, Qbiogene, Inc)ExpressionInsectAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only
-
Notothenia angustata cryaa
Plasmid#47666PurposeRecombinant protein productionDepositorInsertAlpha A-crystallin
ExpressionBacterialPromoterT7Available sinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL(AAA)
Plasmid#25063DepositorInsertBimL (AAA) (BCL2L11 Human)
TagsGstExpressionBacterialMutationChanged serine 44 to alanine Changed threonine 5…Available sinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL (S44A)
Plasmid#24252DepositorInsertBimL(S44A) (BCL2L11 Human)
TagsGstExpressionBacterialMutationChanged Serine 44 to AlanineAvailable sinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL (T56A)
Plasmid#24253DepositorInsertBimL(T56A) (BCL2L11 Human)
TagsGSTExpressionBacterialMutationChanged threonine 56 to alanineAvailable sinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL (S58A)
Plasmid#24254DepositorInsertBimL(S58A) (BCL2L11 Human)
TagsGstExpressionBacterialMutationChanged serine 58 to alanineAvailable sinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimEL (3SA)
Plasmid#23100DepositorInsertBim EL (3SA) (Bcl2l11 Mouse)
TagsGSTExpressionBacterialMutationchanged Serine 55/65/73 to alanineAvailable sinceFeb. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
HisGb1-STAT1(710-750) + CBP TAZ2 (1764-1855)
Plasmid#99342PurposeBacterial expression of mouse CBP TAZ2 domain by coexpression with HisGB1 tagged STAT1 TADDepositorAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
siRNA-resistant ss-SigmaR1DTM-mNeonGreen R119A F191A
Plasmid#226576PurposeEncodes mutant siRNA resistant SigmaR1 protein (transmembrane region deletion + substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationR119A, F191AAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP-Puro-TetOn-L1RP-ORF1_StammerAAA_Halo-GFPai
Plasmid#202571PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the M91A, E92A, and L93A mutations and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorInsertLINE-1
TagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…Available sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM236 - pEXP[Pmlc-2 | histamine | rpl-3 UTR]
Plasmid#159797PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Pmlc-2 | histamine | rpl-3 UTR]
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha Bb-crystallin 1kb promoter/AcGFP
Plasmid#98098PurposeaBb-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha Bb-crystallin promoter 1 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPPromoterDanio aBb-crystallin 1 kb fragment (-1074/-1)Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha A-crystallin 1kb promoter/AcGFP
Plasmid#98096PurposeaA-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha A-crystallin promoter 1 kb fragment, Danio rerio (cryaa Zebrafish)
UseGfp expressingTagsGFPPromoterDanio alpha A-crystallin 1 kb fragment (-1028/-1)Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRESTA-FLAG-CLIP-SNAP-StrepTag
Plasmid#248181PurposeFor the bacterial expression of FLAG-CLIP-SNAP-StrepTag fusion protein.DepositorInsertFLAG-CLIP-SNAP-StrepTag
Use1218TagsHisTag, FLAG, CLIP and SNAP, StrepTagExpressionBacterialMutationWTPromoterT7Available sinceMarch 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-(n1)StayGold(c4)-P2A-mCherry
Plasmid#229603PurposeExpresses (n1)StayGold(c4) and mCherry in mammalian cellsDepositorInsert(n1)StayGold(c4)
UseAAVExpressionMammalianAvailable sinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Start Stuffer TurboID V5 T2A BFP
Plasmid#233257PurposeExpression of BFP-tagged vector for Turbo ID experimentsDepositorInsertTurboID V5 T2A BFP
UseLentiviralAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
CLIPf-KIF5B-SNAPf-HisTag-FLAG
Plasmid#200799PurposeMammalian expression of CLIPf-KIF5B-SNAPf-HisTag-FLAGDepositorInsertKIF5B (KIF5B Human)
TagsCLIPf and SNAPf, HisTag, FLAGExpressionMammalianPromoterCMV & T7Available sinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11-MMEJ
Plasmid#227333PurposeMMEJ Donor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Short Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only