We narrowed to 308 results for: IPTG
-
Plasmid#52734PurposeIPTG-inducible expression of Z-NGFP positive control for in vivo split GFP assembly assayDepositorInsertNGFP+Z-fusion
TagsHis tagExpressionBacterialPromoterT7Available SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMGA-ptac-sfGFP
Plasmid#139934PurposeIPTG-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertLacI-Ptac-sfGFP
ExpressionBacterialAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
DT044A
Plasmid#159405PurposeInducible Perfringolysin O (PFO) expression and purification, controlled under hybrid IPTG-regulated T7/LacO promoter (pRT30)DepositorInsertpr.T7-LacO-6xHis-PFO (Pfo, Clostridium perfringens)
UseSynthetic BiologyTags6xHisExpressionBacterialPromoterT7/LacO promoterAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NR
Plasmid#89625PurposeExpresses recombinant 6HIS tagged T. cruzi nitrate reductase in E. coli upon IPTG inductionDepositorInsertNitrate reductase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKPY514
Plasmid#62598PurposeEncodes Thr251Gly-EcPheRS Under IPTG-Inducible (PT5) ControlDepositorInsertThr251Gly-EcPheRS
Tags6xHisExpressionBacterialMutationThr251GlyPromoterT5Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_K3AK4A
Plasmid#202585PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the K3A and K4A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Lysine 3 to Alanine, changed ORF1p …Available SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a - GR
Plasmid#89614PurposeExpresses recombinant 6HIS tagged T. cruzi Glutathione reductase protein in E. coli upon IPTG inductionDepositorInsertGlutaredoxin
Tags6HISExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAAA
Plasmid#202587PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A, E92A, and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TryX
Plasmid#89623Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi tryparedoxin protein in E. coli upon IPTG inductionDepositorInsertTryparedoxin
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTDpelB-NTwinStrep
Plasmid#45940Purposeuse to create N-terminal PelB-Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal PelB-Twin-Strep-tag and C-terminal 6x His-tag for periplasmic translocation via PelB signal sequenceDepositorTypeEmpty backboneTags6xHis, PelB, and Twin-StrepExpressionBacterialPromoterTrc (lactose/IPTG inducible)Available SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFW2500
Plasmid#224213PurposeBacteroides genomic editing tool; IPTG inducible-Fncpf1 and recTDepositorInsertFncpf1 and recT
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQmod2S-GG
Plasmid#191346PurposeClostridium expression vector (pBP1 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJAB988
Plasmid#133920PurposeminiICE-tet(M)cat(PC194)_PT7-GFP; used to integrate into JAB1000 B. subtilis XPORT strain with IPTG-inducible GFP under T7 promoterDepositorInsertminiICE-tet(M)cat(PC194)_PT7-GFP
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase
Plasmid#87741PurposeIPTG-inducible expression of T4 DNA ligase for protein purificationDepositorAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJWV102-PL-dCas9
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRExpressionBacterialPromoterPLspAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130A wgMDH
Plasmid#204266PurposeBacterial expression of R130A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR130AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124A wgMDH
Plasmid#204257PurposeBacterial expression of R124A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR124AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod3C-GG
Plasmid#191350PurposeClostridium expression vector (pCB102 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196A wgMDH
Plasmid#204271PurposeBacterial expression of R196A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TR
Plasmid#89621Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi trypanothione reductase protein in E. coli upon IPTG inductionDepositorInsertThioredoxin
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMB67EH-Spy
Plasmid#90102PurposeIPTG-inducible CFP/YFP FRET-based biosensor for cyclic-di-GMP measurement using YcgR binding site.DepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXD70LacZ6-LacI-Ptac(LacO)-LacZ
Plasmid#191621PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), IPTG-inducible promoter-lacZ, engineered from pMAL-c2XDepositorInsertlacZ
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod2C-GG
Plasmid#191347PurposeClostridium expression vector (pBP1 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124K wgMDH
Plasmid#204258PurposeBacterial expression of R124K wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR124KAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124Q wgMDH
Plasmid#204259PurposeBacterial expression of R124Q wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR124QAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130E wgMDH
Plasmid#204267PurposeBacterial expression of R130E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR130EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pATmin-GG
Plasmid#191352PurposeClostridium expression vector (pAMB1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only