We narrowed to 535 results for: gcg.2
-
Plasmid#125005PurposeExpresses gRNAs targeting hid, eve, and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only
-
OA-1045B
Plasmid#125004PurposeExpresses gRNAs targeting hid, eve, and hedgehogDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045E
Plasmid#125007PurposeExpresses tRNA-flanked gRNAs targeting hid, eve, and hedgehogDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045A
Plasmid#125003PurposeExpresses gRNAs targeting hid and eveDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bax gRNA#1
Plasmid#171827PurposeCas9-mediated knockout of Bax in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
psgRNAv1-empty
Plasmid#171611PurposesgRNA_v1 plasmid for AsCas12f1 in bacteriaDepositorInsertAsCas12f1_sgRNA_1
ExpressionBacterialAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-cfNHERF2_5
Plasmid#195228PurposeshRNA to canine NHERF2.DepositorInsertNHERF2 (SLC9A3R1 canine)
UseLentiviralAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-C145A-Q306A
Plasmid#177335Purposebacterial expression of inactive SARS-CoV-2 3C-like-C145A proteinaseDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKDsgRNA-rpsL
Plasmid#89953PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rpsL.DepositorInsertrpsL gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
psbA2(noATbox)-PHLS (c)
Plasmid#52308PurposeReplaces the psbA2 gene in Synechocystis with the PHLS geneDepositorInsertsbeta-phellandrene synthase
Chloramphenicol resistance
UseSynthetic BiologyExpressionBacterialMutationCAAATACA box in the psbA2 promoter to ggcgcgccPromoterpsbA2Available SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-trmI
Plasmid#89955PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting trmI.DepositorInserttrmI gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-lpoB
Plasmid#89959PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.DepositorInsertlpoB gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pW317-lenti-sg1-mmItga9-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189947PurposeLentiviral vector to co-express a mouse Itga9 spsgRNA (sg1-Itga9) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itga9 spsgRNA #1
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-B
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Grin1 gRNA#1
Plasmid#169789PurposeCas9-mediated knockout of Grin1 in mammalian cellsDepositorAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only