We narrowed to 11,344 results for: cat.1
-
Plasmid#110196PurposeEncodes for human CXCR4 coding sequence tagged with the mTQ2 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pGL3b(1454/3172)P2P-mut
Plasmid#21405DepositorInsertEGLN1 (EGLN1 Human)
UseLuciferaseExpressionMammalianMutationhypoxia response element mutatedAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSTTa-GPA1-S52N
Plasmid#248649PurposeVector for protein expression of 2x StrepII-tagged Arabidopsis heterotrimeric G protein GPA1-S52N ("inactive" mutant) in E. coli.DepositorInsertGPA1 (GP ALPHA 1 Mustard Weed)
Tags2x StrepII, Thrombin site, TEV siteExpressionBacterialMutationS52NPromotertacAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSTTa-GPA1-Q222L
Plasmid#248650PurposeVector for protein expression of 2x StrepII-tagged Arabidopsis heterotrimeric G protein GPA1-Q222L ("constitutively active" mutant) in E. coli.DepositorInsertGPA1 (GP ALPHA 1 Mustard Weed)
Tags2x StrepII, Thrombin site, TEV siteExpressionBacterialMutationQ222LPromotertacAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-Thrombin-Munc13-1 C1-C2B-MUN-C2C R1598E F1658E (delta1408-1452 delta1533-1551)
Plasmid#243822PurposeMunc13-1 protein purificationDepositorInsertMunc13-1 (Unc13a Rat)
TagsHisExpressionBacterialMutationdelta1408-1452 delta1533-1551 R1598E F1658EAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCELF PAI-RBP v1
Plasmid#45506DepositorAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN435
Plasmid#137867PurposeExpression of gRNA i3 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN446
Plasmid#137868PurposeExpression of gRNA a1 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN454
Plasmid#137865PurposeExpression of gRNA i1 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV1_Rep52-VP1
Plasmid#232174PurposeExpression of replication/capsid proteins for AAV serotype 1DepositorInsertRep52, VP1 of AAV-1
UseAAVExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAJC1
Plasmid#240164PurposeProduction of a thermostable enzyme, Pyrobaculum calidifontis manganese-dependent catalase, to be used in an educational laboratory exercise.DepositorInsertskatPc
Pc- kat
ExpressionBacterialPromoterT7Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyExpressionBacterialPromoterPR promoter and PLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Green cGull
Plasmid#86867PurposeGreen fluorescent probe for cGMPDepositorInsertGreen cGull
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPAP001
Plasmid#153488PurposeLevel 1 episomal expression plasmid for P. pastorisDepositorTypeEmpty backboneExpressionYeastAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPLV_C1
Plasmid#186415PurposeEndogenous murine RNase inhibitor production for cell-free lysateDepositorInsertMurine RNase Inhibitor
UseSynthetic BiologyPromoterT7Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSJ375
Plasmid#103064PurposeExpresses ImmE1, immunity to colicin E1DepositorExpressionBacterialPromoterE1 immunity protein promoter from ColE1Available SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Huc-Positron-ST
Plasmid#129265Purposepan neuronal expression of soma-localized Positron in zebrafishDepositorInsertPositron-ST
UseZebrafish expressionMutationD92N, E199VAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPAP002
Plasmid#153489PurposeLevel 1 episomal expression plasmid for P. pastorisDepositorTypeEmpty backboneExpressionYeastAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only