We narrowed to 4,276 results for: GCA
-
Plasmid#188691PurposesgRNADepositorInsertsgCD4 (CD4 Human)
UseCRISPR and LentiviralTagsExpressionMutationWTPromoterAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int2
Plasmid#188682Purposecontrol sgRNADepositorInsertsgPHGDH intron control (PHGDH Human)
UseCRISPR and LentiviralTagsExpressionMutationWTPromoterAvailable sinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorInsertWhi5-sg106 (WHI5 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRARB.1.0-gDNA
Plasmid#132471PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRARB (RARB Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac5
Plasmid#126885PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_Rac5
Plasmid#126897PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ OBfold
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-TTN-Cerulean
Plasmid#128325PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse TTN for activation
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-BFP)
Plasmid#217305PurposesgRNA BFP + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-BFP
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterU6, Ef1alphaAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgSik1_1st-mU6-sgSik2-hU6-sgSik3_1st
Plasmid#177232PurposeExpresses Sik1(bU6), Sik2 (mU6) and Sik3 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgSik1_1st/sgSik2/sgSik3_1st
UseLentiviralTagsExpressionMutationPromoterbU6/mU6/hU6Available sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135979PurposegRNA against the left loxP site of the Ai9 alleleDepositorInsertAi9 gRNA1
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralTagsExpressionMutationPromoterbU6/mU6/hU6Available sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177233PurposeExpresses Neomycin (bU6), Ampk1 (mU6) and Ampk2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgPrkaa1/sgPrkaa2
UseLentiviralTagsExpressionMutationPromoterbU6/mU6/hU6Available sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorInsertRER2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_MET16
Plasmid#166091PurposePlasmid for constituive spCas9 and tet-inducible MET16 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertMET16 (MET16 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GLK1
Plasmid#166090PurposePlasmid for constituive spCas9 and tet-inducible GLK1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertGLK1 (GLK1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PPE1
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertPPE1 (PPE1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only