We narrowed to 5,049 results for: Mos
-
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 Stop
Plasmid#84895PurposeDONOR vector for Gateway cloning of TAF15DepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-FastFUCCI-IRES-3xnls-mTagBFP2 (JDW 1511)
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIV-NAT-FLAG-CIP2A FL (sg2R)
Plasmid#222624PurposeLentiviral vector that expresses Flag-tagged sgRNA resistant CIP2A in mammalian cellsDepositorInsertCIP2A (CIP2A Human)
UseLentiviralTagsFlagExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT/T0-Flag-CIP2A
Plasmid#222623Purposemammalian expression vector of Flag-tagged CIP2ADepositorAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pME-V5-mClover-KRAS4A-G12D (JDW 813)
Plasmid#242567PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A G12D.DepositorInsertKRAS4A-G12D (KRAS Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCag SE (Self-excising) FlpO-2A-Cre EV
Plasmid#130986Purposeepisomal expression of FlpO and Cre recombinases, self excisingDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianMutationprotamine intron added to FlpO to prevent bacteri…PromoterCMV/Chick β-actin (CAG)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIG-Myc
Plasmid#177650PurposeExpression of wild-type mouse MycDepositorAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-MBP-TEV-BAP-Human BCKDK
Plasmid#232116PurposeFor bacterial expression of Human BCKDK (AA31–412, missing precursor peptide) with an N-terminal biotin acceptor peptide and a cleavable His-MBP purification tag.DepositorInsertBCKDK (BCKDK Human)
Tags6 x His, Biotin acceptor peptide (BAP), Maltose-B…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_Flag
Plasmid#191999PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_untagged-Puro
Plasmid#192001PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I donor only control (F40-based tension sensor)
Plasmid#119188PurposeThe donor (mTFP1) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration and provides the donor only lifetime to determine FRET efficiency.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP(Y67G)] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 No Stop
Plasmid#84896PurposeDONOR vector for Gateway cloning of TAF15 No StopDepositorAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based tension sensor)
Plasmid#118717PurposeThe donor (YPet(short)) only control for the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5E itga11a-cFos
Plasmid#240524Purpose5' Gateway Entry vector containing the itga11a-cFos promoter for fibroblast-specific expression in zebrafishDepositorInsertsUseUnspecifiedAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP-TEV-Rat BCKDK-His
Plasmid#232119PurposeFor bacterial expression of His-tagged Rat BCKDK (AA31-412, missing precursor peptide) with a cleavable MBP purification tag.DepositorInsertBCKDK (Bckdk Rat)
Tags6 x His, Maltose-Binding Protein (MBP), and Tev S…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.1
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseMutationVariant 1 is chr10:128568698-A-G where the inform…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseMutationVariant 2 is chr10:128569418-T-C where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_untagged-Puro
Plasmid#192002PurposeLentiviral vector to generate LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
Plasmid#192004PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_R45W-Puro
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2-I142V-Flag
Plasmid#192006PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorInsertLYSET-Isoform2-I142V-Flag (LYSET Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVTRE3GAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2-R45W-Flag
Plasmid#192005PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorInsertLYSET-Isoform2-R45W (LYSET Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVTRE3GAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGG_Sr1644-1Sh
Plasmid#164087PurposeExpresses pGGG_Sr1644-1Sh in plantsDepositorInsertpGGG_Sr-1644-1Sh
TagsnoneExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based tension sensor)
Plasmid#118719PurposeThe acceptor (mCherry) only control for the F40-based human desmoplakin II tension sensor can be co-expressed with the donor (YPet(short)) only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II-[YPet(short)(Y67G)-F40-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)(Y67G)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting
Plasmid#92139PurposeTargeting vector to introduce a Fucci cell cyle reporter cassette mCherry(G1)/BFP(S/G2) at the mouse TIGRE acceptor locus using puromycin selectionDepositorUseMouse TargetingExpressionMammalianAvailable SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-HygR
Plasmid#118153PurposeSpCas9 expression vectorDepositorInserthSpCas9-T2A-HygR
UseCRISPRTags3XFLAGExpressionMammalianPromoterCAG and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-Q306A
Plasmid#177334Purposebacterial expression of active SARS-CoV-2 3C-like proteinaseDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDNA3-Flag-SPRTN-E112A
Plasmid#110215PurposeExpression in mammalian cells of of full-length SPRTN protein carrying E112A mutation, a catalytically-dead mutant, and Flag-tag at N-terminus.DepositorInsertSPRTN (SPRTN Human)
TagsFlagExpressionMammalianMutationE112A, P296L (see depositor comments below)Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 c1222t No Stop
Plasmid#84900PurposeDONOR vector for Gateway cloning of TAF15 c1222t No StopDepositorAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28 E2 LBD-Tev-E1a-His
Plasmid#232117PurposeFor bacterial expression of a fusion protein containing from N to C-terminus: the lipoyl-binding domain of Human E2, a TEV protease site, a peptide from Human E1a, and a His tag.DepositorInsertDBT (DBT Human)
Tags6xHis, RIGHHSTSDDSSAY (AA331 to 345 (preprocessin…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZL Sox2
Plasmid#26351DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBABE FoxE1
Plasmid#26350DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Sox2 R74P
Plasmid#26355DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide4
Plasmid#125516PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHIV-NAT-FLAG-CIP2A ∆NES (del561-625)
Plasmid#222625PurposeLentiviral vector that expresses Flag-tagged CIP2A NES mutant in mammalian cellsDepositorInsertCIP2A (CIP2A Human)
UseLentiviralTagsFlagExpressionMammalianMutationDeletion of the residues 561-625 (ΔNES)PromoterEF-1-alpha promoterAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiSAMv2 ZFAND3-guide2
Plasmid#125514PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide1
Plasmid#125513PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide3
Plasmid#125515PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 g1172a No Stop
Plasmid#84898PurposeDONOR vector for Gateway cloning of TAF15 g1172a No StopDepositorAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 VPS13C-TSS-guide1
Plasmid#125476PurposeCRISPR-mediated activation of VPS13C. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.28H.28TM.BB.3z
Plasmid#200679PurposeModular CD28hinge-CD28transmembrane-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only