We narrowed to 13,284 results for: sequence
-
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pTBL2142 MTK3-sfGFP
Plasmid#226661PurposeMTK3 part containing the coding sequence of sfGFPDepositorInsertsfGFP
UseSynthetic BiologyExpressionMammalianPromoternoneAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIBN(deltaNLS)-pmGFP
Plasmid#26867PurposeExpresses CIBN(1-170, -NLS)-eGFP-CaaX fusion for use in light-inducible protein interaction modules for targeting to the plasma membraneDepositorInsertCIBN(deltaNLS)-pmGFP (CIB1 Mustard Weed)
TagsEGFPExpressionMammalianMutationNLS sequences mutatedPromoterCMVAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pQE81L-KOFP7
Plasmid#160330PurposeThis plasmid encodes an engineered oxygen-independent flavin binding fluorescent protein with N-terminal 6xHis tag. Its quantum yield is comparable to EGFP.DepositorInsertKOFP7
Tags6xHis tagExpressionBacterialPromoterT5Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-GFP-cytoB5RR
Plasmid#182577PurposeExpresses LifeAct-GFP targeted to the ER via the CytB5RR tail anchor sequenceDepositorInsertLifeAct-GFP-cytoB5RR
TagsLifeAct and cytoB5RRExpressionMammalianAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER-GA
Plasmid#209871PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-B
Plasmid#209870PurposeDimerization dependent fluorescent protein B anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP B
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FlipCherry-T2A-GFP
Plasmid#124436PurposeExpresses FlipCherry (TEV cleavage sequence) and T2A GFP in mammalian cellsDepositorInsertFlipCherry-T2A-GFP
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only