We narrowed to 11,348 results for: cat.1
-
Plasmid#171237PurposeMammalian expression of 2xHA-tagged human androgen receptor trancate: AR DNA-bindind domain and Ligand-binding domain (DBD-LBD)DepositorInsert2xHA-tagged human androgen receptor trancate:DNA-binding domain and Ligand-binding domain (AR Human)
TagsHAExpressionBacterial and MammalianMutationAR truncatePromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gfp-rt-vasa
Plasmid#167322PurposePlasmid for synthesis of GFP chimeric RNA that contained vasa-3'UTRs of rainbow trout by in vitro transcription.DepositorInsertrt vasa 3'UTRs (ddx4 rainbow trout)
ExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTP298 His14-Avi-27xGS-SUMOEu-2xGS-anti ALFA tag nanobody
Plasmid#199390PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag, biotin acceptor peptide (Avi), and SUMOEu tagDepositorInsertanti-ALFA nanobody
Tags14xHis-Avi-SUMOEuExpressionBacterialPromoterT5-LacOAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-RFP
Plasmid#1817PurposeMammalian expression of Lamp1 fused to RFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsRFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLV_3XHA-ATP6V1B2-mNeonGreen
Plasmid#228865PurposeStable expression of V-ATPase subunit ATP6V1B2 with N-terminal 3xHA and C-terminal mNeonGreenDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLS13-IL-10
Plasmid#209128PurposeTransient mammalian expression of IL-10DepositorInsertIL-10 (IL10 Human)
ExpressionMammalianAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV Flag PAI-RBP
Plasmid#45452DepositorAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-YFP
Plasmid#1816PurposeMammalian expression of Lamp1 fused to YFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsYFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceFeb. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1_CD
Plasmid#83571PurposeExpresses a mutant catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deleted, catalytic domain…PromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
T7-p53DD-pcDNA3
Plasmid#25989DepositorInserttumor protein p53 (TP53 Human)
TagsT7ExpressionMammalianMutationtruncated cDNA encodes truncated protein (aa 300-…Available SinceOct. 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-gamma-tubulin
Plasmid#87956PurposeExpresses human gamma-tubulin with a GFP-tag on the C-terminal of the proteinDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene …Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 His-GFP-EWSR1-myc-His
Plasmid#46385Purposeexpresses EGFP tagged EWSR1 in mammalian cellsDepositorAvailable SinceSept. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
hSUMO1 GFP
Plasmid#118360PurposeThis plasmid expresses the full length human SUMO1.DepositorAvailable SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mTet1s pc3901
Plasmid#201700PurposeExpresses of GFP-tagged mTet1s in mammalian cellsDepositorAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-ECFP-betaPIXa
Plasmid#15235DepositorAvailable SinceSept. 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-IFIH1-ts2
Plasmid#174260PurposeIFIH1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
hHSF1 K298R
Plasmid#118362PurposeThis plasmid expresses human HSF1 K298R mutant, which cannot undergo sumoylation on K298.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-161;+80pCalb2
Plasmid#66745Purposeluciferase reporter for Calb2 promoter (-161to +80, WT)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-264;+80pCalb2
Plasmid#66746Purposeluciferase reporter for Calb2 promoter (-264 to +80, WT)DepositorInsertCalb2 promoter (-264bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-419;+80pCalb2
Plasmid#66747Purposeluciferase reporter for Calb2 promoter (-419 to +80, WT)DepositorInsertCalb2 promoter (-419bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-his-Gluc-iLID
Plasmid#172096PurposeExpresses a fusion protein of Gluc and iLID, which dimerizes with a sspB-tagged protein when the bioluminescent reaction is initiated, in bacteriaDepositorInsertGaussia Luciferase - iLID
ExpressionBacterialMutationGluc Mutations - M43L, M110LPromoterT7Available SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303A
Plasmid#118363PurposeThis plasmid expresses human HSF1 S303A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Gluc-EL222-his
Plasmid#172097PurposeExpresses the fusion protein of Gluc and the light-activated transcription factor EL222 in bacteriaDepositorInsertGaussia Luciferase - EL222
ExpressionBacterialMutationGluc mutations - M43L, M110LPromoterT7Available SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4-ADCY6-C1(306-672 aa)
Plasmid#113903PurposeHis-S tagged cytoplasmic catalytic domain 1 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 1 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1281)
Plasmid#192955PurposeFor membrane insertion study; Expresses tse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1281)
ExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-838;+80pCalb2
Plasmid#66750Purposeluciferase reporter for Calb2 promoter (-838 to +80, WT)DepositorInsertCalb2 promoter (-838bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT21
Plasmid#78102Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 2…PromoterT7Available SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT13
Plasmid#75087Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 4…Available SinceMay 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1ct-ssrA2-mCerulean
Plasmid#223690PurposePhoBIT2 component; ssrA2 tag (ssrA mutant A2C) inserted into mCerulean-tagged STIM1 cytoplasmic domainDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8
Plasmid#224343PurposeExpresses human KDAC8 (HDAC8) in insect cellsDepositorAvailable SinceFeb. 26, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc C1)
Plasmid#221273PurposeExpression of IRSp53 C-terminal truncation 1 (247-355) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc N1)
Plasmid#221272PurposeExpression of IRSp53 N-terminal truncation 1 (257-375) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-SLD2
Plasmid#210263PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-SLD2. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-SLD2 (aa 1-343) (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-SLD2PromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1229)
Plasmid#192948PurposeFor membrane insertion study; expresses Tse5-CT (1169-1229)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1229)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1300)
Plasmid#192956PurposeFor membrane insertion study; Expresses tse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1300)
ExpressionBacterialMutationencodes for tse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1317)
Plasmid#192957PurposeFor membrane insertion study; Expresses tse5-CT (1169-1317) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1317)
ExpressionBacterialMutationencodes for tse5 (1169-1317)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1269)
Plasmid#192954PurposeFor membrane insertion study; Expresses tse5-CT (1169-1269) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1269)
ExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::sptse5-CT_phoA-lacZalpha
Plasmid#192961PurposeTest the biological function of the spTse5-CT (1169-1317)-PhoA (22-474)-LacZ (4-60) fusion protein in P. putidaDepositorInsertsptse5-CT_phoA-lacZ_
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1317) fused to phoA-lacZal…Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1229)
Plasmid#192953PurposeFor membrane insertion study; Expresses tse5-CT (1169-1229) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1229)
ExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1281)
Plasmid#192950PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1281)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1269)
Plasmid#192949PurposeFor membrane insertion study; Expresses Tse5-CT (1169-1269)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1269)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1300)
Plasmid#192951PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1300)
TagsPelB signal peptideExpressionBacterialMutationencodes for sptse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-Citrine-ADPG2
Plasmid#170725PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneTagsCitrine tag (714bp)Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only